CoFold fix

README.md

@@ -11,7 +11,7 @@ to display.
 Below is an example of a simple web page which uses a `FornaContainer` to show
 a simple RNA molecule:
 
-![blah blah](https://raw.githubusercontent.com/pkerpedjiev/fornac/develop/doc/img/forna-container-screenshot.png "An example of the FornaContainer")
+<img src="./doc/img/forna-container-screenshot.png" width="150">
 
 The code for creating this web page is rather straightforward. After importing
 some necessary javascript files, we create a container using `new
@@ -44,7 +44,7 @@ This after the RNA container.
 
 Display two cofolded sequences using the format of [RNAcofold](http://rna.tbi.univie.ac.at/cgi-bin/RNAcofold.cgi):
 
-![Cofolded sequences](https://raw.githubusercontent.com/pkerpedjiev/fornac/master/doc/img/cofold_example.png "An example of cofolded sequences displayed using the FornaContainer")
+<img src="./doc/img/cofold_example.png" width="150">
 
 ```javascript
     var container = new fornac.FornaContainer("#cofold_ss",
@@ -91,7 +91,7 @@ This only makes sense in connection with the `animation` argument. If it's
 true, the external loops will be arranged in a nice circle. If false, they will
 be allowed to flop around as the force layout dictates:
 
-<img src="https://github.com/pkerpedjiev/fornac/blob/master/doc/img/uncircularized_exterior.png" width=200 align=center />
+<img src="./doc/img/uncircularized_exterior.png" width="150">
 
 ### labelInterval [default=10]
 

dist/fornac.js.LICENSE.txt

@@ -0,0 +1,8 @@
+/*!
+ * The buffer module from node.js, for the browser.
+ *
+ * @author   Feross Aboukhadijeh <https://feross.org>
+ * @license  MIT
+ */
+
+/*! ieee754. BSD-3-Clause License. Feross Aboukhadijeh <https://feross.org/opensource> */

examples/demo.html

@@ -95,7 +95,7 @@ <h4>This is a custom-colored RNA</h4>
 
     function cofoldContainer() {
         var container = new fornac.FornaContainer("#cofold_ss",
-                {'animation': true, 'zoomable': false, 'initialSize':[500,300]});
+                {'animation': false, 'zoomable': false, 'initialSize':[500,300]});
 
         var options = {'structure': '..((((...))))...((...((...((..&............))...))...))..',
                         'sequence': 'ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG'

src/fornac.js

@@ -1490,6 +1490,107 @@ export function FornaContainer(element, passedOptions = {}) {
         // add them back to the plot
     }
 
+    let splitMultiStrand = function(rna) {
+        // split a multi strand RNA into its individual strands
+        // get the position of the '&' character in the dotbracket string
+        let breakPositions = [];
+        for (let i = 0; i < rna.dotbracket.length; i++) {
+            if (rna.dotbracket[i] == '&') {
+                breakPositions.push(i);
+            }
+        }
+
+        let toRemove = [];
+        // collect all the base pairs that are between split strands
+        for (let i = 0; i < rna.links.length; i++) {
+            let link = rna.links[i];
+
+            if (link.linkType != 'basepair')
+                continue; // only consider base pairs
+
+            for (let j = 0; j < breakPositions.length; j++) {
+                let node = rna.nodes[breakPositions[j]]; // take the split node
+                // take the two links that connect the split node 
+                let linkSource = rna.links.filter(link => link.source === node)[0];
+                let linkTarget = rna.links.filter(link => link.target === node)[0];
+                if (link.source.num <= linkSource.source.num && link.target.num >= linkTarget.target.num) {
+                    console.log('crossing basepair', link);
+                    link.breakFrom = 0;
+                    // find the strand that the source is in
+                    for (let k = 0; k < breakPositions.length - 1; k++) {
+                        if (link.source.num > breakPositions[k] && link.source.num < breakPositions[k+1])
+                            link.breakFrom = k+1;
+                    }
+                    // find the strand that the target is in
+                    link.breakTo = j+1; 
+                    link.from = link.source.num;
+                    // find the position of the source in the strand
+                    if (link.breakFrom > 0) link.from -= breakPositions[link.breakFrom-1] + link.breakFrom;
+                    // find the position of the target in the strand
+                    link.to = link.target.num - linkTarget.target.num;
+                    toRemove.push(link);
+                }
+            }
+        }
+
+
+        // Remove all base pairs that are between these two nodes and add them as extra
+        // links
+        console.log('toRemove:', toRemove);
+        let sequences = rna.seq.split('&');
+
+        // remove the base pairs
+        for (let i = 0; i < toRemove.length; i++) {
+            rna.pairtable[toRemove[i].source.num] = 0;
+            rna.pairtable[toRemove[i].target.num] = 0;
+        }
+
+        // extract the dotbracket string of the rna
+        // cut it at the position of this backbone bond
+        console.log('sequences:', sequences);
+
+        let rnaDotBracket = rnaUtilities.pairtableToDotbracket(rna.pairtable);
+        let dotbrackets = []; // array to hold the dotbracket strings of the individual strands
+        let rnaPositions = rna.getPositions('nucleotide') // get the nucleotide positions, cut them at the positions of the backbone bond
+        let positions = [];
+        let rnaUids = rna.getUids();
+        let uids = [];
+        let lastBreak = 0; // the position of the last break
+        for (let i = 0; i <= breakPositions.length; i++) {
+            // cut the dotbracket
+            dotbrackets.push(rnaDotBracket.slice(lastBreak, breakPositions[i]));
+            // add the positions
+            positions.push(rnaPositions.slice(lastBreak, breakPositions[i]));
+            // add the uids
+            uids.push(rnaUids.slice(lastBreak, breakPositions[i]));
+            lastBreak = breakPositions[i] + 1;
+        }
+
+        console.log('positions:', positions);
+
+        delete self.rnas[rna.uid];
+        let newRnas = [];
+        for (let i = 0; i < sequences.length; i++) {
+            let newRna = self.addRNA(dotbrackets[i], { 'sequence': sequences[i],
+                                      'positions': positions[i],    
+                                        'uids': uids[i] });
+            newRnas.push(newRna);
+        }
+        // add the extra links
+        for (let i = 0; i < toRemove.length; i++) {
+            console.log('toRemove[i]', toRemove[i]);
+            self.extraLinks.push(
+                {'source': newRnas[toRemove[i].breakFrom].nodes[toRemove[i].from-1],
+                 'target': newRnas[toRemove[i].breakTo].nodes[toRemove[i].to-1],
+                 'value': 1,
+                 'uid': slugid.nice(),
+                 'linkType': 'intermolecule'});
+                recalculateGraph();
+                self.update();
+        }
+        console.log('self.extraLinks:', self.extraLinks);
+    }
+
     var removeLink = function(d) {
         // remove a link between two nodes
         let index = self.graph.links.indexOf(d);
@@ -1907,6 +2008,13 @@ export function FornaContainer(element, passedOptions = {}) {
         else
             self.addRNAJSON(rnaJson, {centerView: passedOptions.centerView});
 
+        // if the structure containes multistrands, let's split before the '&'
+        console.log('structure:', structure);
+        if (structure.indexOf('&') !== -1 && structure != '&' && structure.indexOf('&') !== 0) {
+            console.log('splitting multistrand');
+            splitMultiStrand(rnaJson);
+            return;
+        };
         return rnaJson;
     };
 
@@ -2126,7 +2234,7 @@ export function FornaContainer(element, passedOptions = {}) {
                 if (node.nodeType != 'nucleotide')
                     continue;
 
-                console.log('node:', node);
+                // console.log('node:', node);
                 nodeIdxs[node.uid] = currIdx;
                 currIdx += 1;