miRBench package can be easily installed using pip:
pip install miRBench
Default installation allows access to the datasets. To use predictors and encoders, you need to install additional dependencies.
To use miRBench with predictors and encoders, install the following dependencies:
- numpy
- biopython
- viennarna
- torch
- tensorflow
- typing-extensions
To install the miRBench package with all dependencies into a virtual environment, you can use the following commands:
python3.8 -m venv mirbench_venv
source mirbench_venv/bin/activate
pip install miRBench
pip install numpy==1.24.3 biopython==1.83 viennarna==2.7.0 torch==1.9.0 tensorflow==2.13.1 typing-extensions==4.5.0
Note: This instalation is for running predictors on the CPU. If you want to use GPU, you need to install version of torch and tensorflow with GPU support.
from miRBench.dataset import list_datasets
list_datasets()
['AGO2_CLASH_Hejret2023',
'AGO2_eCLIP_Klimentova2022',
'AGO2_eCLIP_Manakov2022']
Not all datasets are available with all splits and ratios. To get available splits, use the full
option.
list_datasets(full=True)
{'AGO2_CLASH_Hejret2023': {'splits': ['train', 'test']},
'AGO2_eCLIP_Klimentova2022': {'splits': ['test']},
'AGO2_eCLIP_Manakov2022': {'splits': ['train', 'test', 'leftout']}}
from miRBench.dataset import get_dataset_df
dataset_name = "AGO2_CLASH_Hejret2023"
df = get_dataset_df(dataset_name, split="test")
df.head()
gene | noncodingRNA | noncodingRNA_name | noncodingRNA_fam | feature | label | chr | start | end | strand | gene_cluster_ID | |
---|---|---|---|---|---|---|---|---|---|---|---|
0 | AAAGCTGTGGAACGCTACCTCTTCCTTTGAG... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 212100882 | 212100931 | + | 2391 |
1 | TCACCTCAGACTCTGTCCAACCTCTGCCTCA... | TGAGGTAGTAGGTTGTGTGGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 35913919 | 35913968 | + | 3972 |
2 | TTATATGTGCCCAGTGTGGCAAAACCTTCAA... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 42851209 | 42851258 | + | 222 |
3 | TGAGGCCCTCTTCCTGCTCGTCACCTCCGTC... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 43961210 | 43961259 | + | 1253 |
4 | ATAAAATTTACGTTTTTAACTATACAATCTAC... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | intron | 1 | 1 | 244661046 | 244661095 | + | 1252 |
If you want to get just a path to the dataset, use the get_dataset_path
function:
from miRBench.dataset import get_dataset_path
dataset_path = get_dataset_path(dataset_name, split="test")
dataset_path
/home/user/.miRBench/datasets/14501607/AGO2_CLASH_Hejret2023/test/dataset.tsv
from miRBench.predictor import list_predictors
list_predictors()
['CnnMirTarget_Zheng2020',
'RNACofold',
'miRNA_CNN_Hejret2023',
'miRBind_Klimentova2022',
'TargetNet_Min2021',
'Seed8mer',
'Seed7mer',
'Seed6mer',
'Seed6merBulgeOrMismatch',
'TargetScanCnn_McGeary2019',
'InteractionAwareModel_Yang2024']
from miRBench.encoder import get_encoder
tool = 'miRBind_Klimentova2022'
encoder = get_encoder(tool)
input = encoder(df)
from miRBench.predictor import get_predictor
predictor = get_predictor(tool)
predictions = predictor(input)
predictions[:10]
array([0.6899161 , 0.15220629, 0.07301956, 0.43757868, 0.34360734,
0.20519172, 0.0955029 , 0.79298246, 0.14150576, 0.05329492],
dtype=float32)