See the http://rosalind.info/problems/prot/ for the fully detailed problem description.
The input consists of string of triplets made of letters A, C, G, and U. These triplets are called codons. Each codon encodes a specific amino acid. These amino acids are abbreviated using single English letters and represent protein string encoded by the corresponding RNA codons.
The RNA input string must follow additional rules:
- It must start with AUG codon.
- It must end with one of UAA, UAG, or UGA codons.
- UAA, UAG, and UGA codons cannot be in the middle of RNA.
Sample input:
AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA
translates into:
MAMAPRTEINSTRING
In the project directory, you can run:
Runs the app in the development mode.
Open http://localhost:3000 to view it in the browser.
Launches the test runner in the interactive watch mode.
Builds the app for production to the build
folder.
Michal Molhanec michal@molhanec.net