From c18174de1dfdb0fc100afd4a69bd74b4b2d7f5b0 Mon Sep 17 00:00:00 2001 From: scarlhoff Date: Fri, 9 Aug 2024 10:59:55 +0200 Subject: [PATCH 01/36] add raw library merging + publishing --- conf/modules.config | 53 +++++++++++++++++++++++++++++++++++------ workflows/eager.nf | 58 +++++++++++++++++++++++++-------------------- 2 files changed, 78 insertions(+), 33 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 37c5d666b..bc41e822d 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -951,7 +951,7 @@ process { // LIBRARY MERGE // - withName: SAMTOOLS_MERGE_LIBRARIES { + withName: ".*MERGE_LIBRARIES:SAMTOOLS_MERGE_LIBRARIES" { tag = { "${meta.reference}|${meta.sample_id}" } ext.prefix = { "${meta.sample_id}_${meta.reference}_unsorted" } publishDir = [ @@ -959,32 +959,71 @@ process { ] } - withName: SAMTOOLS_SORT_MERGED_LIBRARIES { + withName: ".*MERGE_LIBRARIES:SAMTOOLS_SORT_MERGED_LIBRARIES" { tag = { "${meta.reference}|${meta.sample_id}" } ext.prefix = { "${meta.sample_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/final_bams/" }, + path: { "${params.outdir}/final_bams/raw/" }, mode: params.publish_dir_mode, pattern: '*.bam' ] } - withName: SAMTOOLS_INDEX_MERGED_LIBRARIES { + withName: ".*MERGE_LIBRARIES:SAMTOOLS_INDEX_MERGED_LIBRARIES" { tag = { "${meta.reference}|${meta.sample_id}" } ext.args = { params.fasta_largeref ? "-c" : "" } ext.prefix = { "${meta.sample_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/final_bams/" }, + path: { "${params.outdir}/final_bams/raw/" }, mode: params.publish_dir_mode, pattern: '*.{bai,csi}' ] } - withName: SAMTOOLS_FLAGSTAT_MERGED_LIBRARIES { + withName: ".*MERGE_LIBRARIES:SAMTOOLS_FLAGSTAT_MERGED_LIBRARIES" { tag = { "${meta.reference}|${meta.sample_id}" } ext.prefix = { "${meta.sample_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/final_bams/" }, + path: { "${params.outdir}/final_bams/raw/" }, + mode: params.publish_dir_mode, + pattern: '*.flagstat' + ] + } + + withName: ".*MERGE_LIBRARIES:SAMTOOLS_MERGE_LIBRARIES" { + tag = { "${meta.reference}|${meta.sample_id}" } + ext.prefix = { "${meta.sample_id}_${meta.reference}_unsorted" } + publishDir = [ + enabled: false + ] + } + + withName: ".*MERGE_LIBRARIES_GENOTYPING:SAMTOOLS_SORT_MERGED_LIBRARIES" { + tag = { "${meta.reference}|${meta.sample_id}" } + ext.prefix = { "${meta.sample_id}_${meta.reference}" } + publishDir = [ + path: { "${params.outdir}/final_bams/for_genotyping/" }, + mode: params.publish_dir_mode, + pattern: '*.bam' + ] + } + + withName: ".*MERGE_LIBRARIES_GENOTYPING:SAMTOOLS_INDEX_MERGED_LIBRARIES" { + tag = { "${meta.reference}|${meta.sample_id}" } + ext.args = { params.fasta_largeref ? "-c" : "" } + ext.prefix = { "${meta.sample_id}_${meta.reference}" } + publishDir = [ + path: { "${params.outdir}/final_bams/for_genotyping/" }, + mode: params.publish_dir_mode, + pattern: '*.{bai,csi}' + ] + } + + withName: ".*MERGE_LIBRARIES_GENOTYPING:SAMTOOLS_FLAGSTAT_MERGED_LIBRARIES" { + tag = { "${meta.reference}|${meta.sample_id}" } + ext.prefix = { "${meta.sample_id}_${meta.reference}" } + publishDir = [ + path: { "${params.outdir}/final_bams/for_genotyping/" }, mode: params.publish_dir_mode, pattern: '*.flagstat' ] diff --git a/workflows/eager.nf b/workflows/eager.nf index fee976267..f7fc00f1a 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -21,18 +21,19 @@ include { addNewMetaFromAttributes } from '../subworkflows/local/utils_nfcore_ea // // TODO rename to active: index_reference, filter_bam etc. -include { REFERENCE_INDEXING } from '../subworkflows/local/reference_indexing' -include { PREPROCESSING } from '../subworkflows/local/preprocessing' -include { MAP } from '../subworkflows/local/map' -include { FILTER_BAM } from '../subworkflows/local/bamfiltering.nf' -include { DEDUPLICATE } from '../subworkflows/local/deduplicate' -include { MANIPULATE_DAMAGE } from '../subworkflows/local/manipulate_damage' -include { METAGENOMICS_COMPLEXITYFILTER } from '../subworkflows/local/metagenomics_complexityfilter' -include { ESTIMATE_CONTAMINATION } from '../subworkflows/local/estimate_contamination' -include { CALCULATE_DAMAGE } from '../subworkflows/local/calculate_damage' -include { RUN_SEXDETERRMINE } from '../subworkflows/local/run_sex_determination' -include { MERGE_LIBRARIES } from '../subworkflows/local/merge_libraries' -include { GENOTYPE } from '../subworkflows/local/genotype' +include { REFERENCE_INDEXING } from '../subworkflows/local/reference_indexing' +include { PREPROCESSING } from '../subworkflows/local/preprocessing' +include { MAP } from '../subworkflows/local/map' +include { FILTER_BAM } from '../subworkflows/local/bamfiltering.nf' +include { DEDUPLICATE } from '../subworkflows/local/deduplicate' +include { MANIPULATE_DAMAGE } from '../subworkflows/local/manipulate_damage' +include { METAGENOMICS_COMPLEXITYFILTER } from '../subworkflows/local/metagenomics_complexityfilter' +include { ESTIMATE_CONTAMINATION } from '../subworkflows/local/estimate_contamination' +include { CALCULATE_DAMAGE } from '../subworkflows/local/calculate_damage' +include { RUN_SEXDETERRMINE } from '../subworkflows/local/run_sex_determination' +include { MERGE_LIBRARIES } from '../subworkflows/local/merge_libraries' +include { MERGE_LIBRARIES as MERGE_LIBRARIES_GENOTYPING } from '../subworkflows/local/merge_libraries' +include { GENOTYPE } from '../subworkflows/local/genotype' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -264,6 +265,15 @@ workflow EAGER { ch_dedupped_flagstat = Channel.empty() } + // + // SUBWORKFLOW: Merge libraries per sample + // + + MERGE_LIBRARIES ( ch_dedupped_bams ) + ch_versions = ch_versions.mix( MERGE_LIBRARIES.out.versions ) + ch_merged_dedup_bams = MERGE_LIBRARIES.out.bam_bai + ch_multiqc_files = ch_multiqc_files.mix( MERGE_LIBRARIES.out.mqc.collect{it[1]}.ifEmpty([]) ) + // // MODULE QUALIMAP // @@ -538,27 +548,23 @@ workflow EAGER { // // SUBWORKFLOW: aDNA Damage Manipulation + // if ( params.run_mapdamage_rescaling || params.run_pmd_filtering || params.run_trim_bam ) { MANIPULATE_DAMAGE( ch_dedupped_bams, ch_fasta_for_deduplication.fasta, REFERENCE_INDEXING.out.pmd_masking ) - ch_multiqc_files = ch_multiqc_files.mix( MANIPULATE_DAMAGE.out.flagstat.collect{it[1]}.ifEmpty([]) ) - ch_versions = ch_versions.mix( MANIPULATE_DAMAGE.out.versions ) + ch_multiqc_files = ch_multiqc_files.mix( MANIPULATE_DAMAGE.out.flagstat.collect{it[1]}.ifEmpty([]) ) + ch_versions = ch_versions.mix( MANIPULATE_DAMAGE.out.versions ) ch_bams_for_library_merge = params.genotyping_source == 'rescaled' ? MANIPULATE_DAMAGE.out.rescaled : params.genotyping_source == 'pmd' ? MANIPULATE_DAMAGE.out.filtered : params.genotyping_source == 'trimmed' ? MANIPULATE_DAMAGE.out.trimmed : ch_dedupped_bams + + // SUBWORKFLOW: merge libraries for genotyping + MERGE_LIBRARIES_GENOTYPING ( ch_bams_for_library_merge ) + ch_versions = ch_versions.mix( MERGE_LIBRARIES_GENOTYPING.out.versions ) + ch_bams_for_genotyping = MERGE_LIBRARIES_GENOTYPING.out.bam_bai + ch_multiqc_files = ch_multiqc_files.mix( MERGE_LIBRARIES_GENOTYPING.out.mqc.collect{it[1]}.ifEmpty([]) ) } else { - ch_bams_for_library_merge = ch_dedupped_bams + ch_bams_for_genotyping = ch_merged_dedup_bams } - // - // SUBWORKFLOW: MERGE LIBRARIES - // - - // The bams being merged are always the ones specified by params.genotyping_source, - // unless the user skipped damage manipulation, in which case it is the DEDUPLICATION output. - MERGE_LIBRARIES ( ch_bams_for_library_merge ) - ch_versions = ch_versions.mix( MERGE_LIBRARIES.out.versions ) - ch_bams_for_genotyping = MERGE_LIBRARIES.out.bam_bai - ch_multiqc_files = ch_multiqc_files.mix( MERGE_LIBRARIES.out.mqc.collect{it[1]}.ifEmpty([]) ) // Not sure if this is needed, or if it needs to be moved to line 564? - // // SUBWORKFLOW: Genotyping // From d2983efbffe247a62f62809600b3bb4fa325c343 Mon Sep 17 00:00:00 2001 From: scarlhoff Date: Fri, 9 Aug 2024 11:09:52 +0200 Subject: [PATCH 02/36] merged input for bedtools, qualimap, sex det --- conf/modules.config | 20 ++++++++++++-------- workflows/eager.nf | 6 +++--- 2 files changed, 15 insertions(+), 11 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index bc41e822d..f91a741c0 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -668,16 +668,16 @@ process { // BEDTOOLS_COVERAGE // withName: SAMTOOLS_VIEW_GENOME { - tag = { "${meta.reference}|${meta.sample_id}_${meta.library_id}" } + tag = { "${meta.reference}|${meta.sample_id}" } publishDir = [ enabled: false ] } withName: BEDTOOLS_COVERAGE_DEPTH { - tag = { "${meta.reference}|${meta.sample_id}_${meta.library_id}" } + tag = { "${meta.reference}|${meta.sample_id}" } ext.args = '-mean -nonamecheck' - ext.prefix = { "${meta.sample_id}_${meta.library_id}_${meta.reference}_depth" } + ext.prefix = { "${meta.sample_id}_${meta.reference}_depth" } publishDir = [ path: { "${params.outdir}/mapstats/bedtools" }, mode: params.publish_dir_mode @@ -685,9 +685,9 @@ process { } withName: BEDTOOLS_COVERAGE_BREADTH { - tag = { "${meta.reference}|${meta.sample_id}_${meta.library_id}" } + tag = { "${meta.reference}|${meta.sample_id}" } ext.args = '-nonamecheck' - ext.prefix = { "${meta.sample_id}_${meta.library_id}_${meta.reference}_breadth" } + ext.prefix = { "${meta.sample_id}_${meta.reference}_breadth" } publishDir = [ path: { "${params.outdir}/mapstats/bedtools" }, mode: params.publish_dir_mode @@ -880,8 +880,12 @@ process { ] } + // + // QUALIMAP + // + withName: 'QUALIMAP_BAMQC_WITHBED|QUALIMAP_BAMQC_NOBED' { - tag = { "${meta.reference}|${meta.sample_id}_${meta.library_id}" } + tag = { "${meta.reference}|${meta.sample_id}" } publishDir = [ path: { "${params.outdir}/mapstats/qualimap/${meta.reference}/${meta.sample_id}/}" }, mode: params.publish_dir_mode, @@ -928,7 +932,7 @@ process { // RUN SEXDETERRMINE // withName: SAMTOOLS_DEPTH_SEXDETERRMINE { - tag = { "${meta1.reference}|${meta1.sample_id}_${meta1.library_id}" } + tag = { "${meta1.reference}|${meta1.sample_id}" } ext.prefix = { "${meta2.id}_samtoolsdepth" } ext.args = '-aa -q30 -Q30 -H' publishDir = [ @@ -937,7 +941,7 @@ process { } withName: SEXDETERRMINE { - tag = { "${meta.reference}|${meta.sample_id}_${meta.library_id}" } + tag = { "${meta.reference}|${meta.sample_id}" } ext.prefix = { "${meta.reference}_sexdeterrmine" } publishDir = [ path: { "${params.outdir}/sex_determination/" }, diff --git a/workflows/eager.nf b/workflows/eager.nf index f7fc00f1a..a6db6da16 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -283,7 +283,7 @@ workflow EAGER { .map{ addNewMetaFromAttributes( it, "id" , "reference" , false ) } - ch_qualimap_input = ch_dedupped_bams + ch_qualimap_input = ch_merged_dedup_bams .map { meta, bam, bai -> [ meta, bam ] @@ -466,7 +466,7 @@ workflow EAGER { addNewMetaFromAttributes( it, "id" , "reference" , false ) } - ch_bedtools_prep = ch_dedupped_bams + ch_bedtools_prep = ch_merged_dedup_bams .map { addNewMetaFromAttributes( it, "reference" , "reference" , false ) } @@ -527,7 +527,7 @@ workflow EAGER { // if ( params.run_sexdeterrmine ) { - ch_sexdeterrmine_input = ch_dedupped_bams + ch_sexdeterrmine_input = ch_merged_dedup_bams RUN_SEXDETERRMINE(ch_sexdeterrmine_input, REFERENCE_INDEXING.out.sexdeterrmine_bed ) ch_versions = ch_versions.mix( RUN_SEXDETERRMINE.out.versions ) From 976c5cffd3c3e95b0c22fbf05a2bb4e17c894b56 Mon Sep 17 00:00:00 2001 From: Selina Carlhoff <73653549+scarlhoff@users.noreply.github.com> Date: Fri, 13 Sep 2024 14:50:48 +0200 Subject: [PATCH 03/36] Apply suggestions from code review Co-authored-by: Thiseas C. Lamnidis --- conf/modules.config | 6 +++--- workflows/eager.nf | 2 +- 2 files changed, 4 insertions(+), 4 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index f91a741c0..aa4c9eba7 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -1006,7 +1006,7 @@ process { tag = { "${meta.reference}|${meta.sample_id}" } ext.prefix = { "${meta.sample_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/final_bams/for_genotyping/" }, + path: { "${params.outdir}/final_bams/${params.genotyping_source}/" }, mode: params.publish_dir_mode, pattern: '*.bam' ] @@ -1017,7 +1017,7 @@ process { ext.args = { params.fasta_largeref ? "-c" : "" } ext.prefix = { "${meta.sample_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/final_bams/for_genotyping/" }, + path: { "${params.outdir}/final_bams/${params.genotyping_source}/" }, mode: params.publish_dir_mode, pattern: '*.{bai,csi}' ] @@ -1027,7 +1027,7 @@ process { tag = { "${meta.reference}|${meta.sample_id}" } ext.prefix = { "${meta.sample_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/final_bams/for_genotyping/" }, + path: { "${params.outdir}/final_bams/${params.genotyping_source}/" }, mode: params.publish_dir_mode, pattern: '*.flagstat' ] diff --git a/workflows/eager.nf b/workflows/eager.nf index a6db6da16..65bf4c407 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -554,7 +554,7 @@ workflow EAGER { MANIPULATE_DAMAGE( ch_dedupped_bams, ch_fasta_for_deduplication.fasta, REFERENCE_INDEXING.out.pmd_masking ) ch_multiqc_files = ch_multiqc_files.mix( MANIPULATE_DAMAGE.out.flagstat.collect{it[1]}.ifEmpty([]) ) ch_versions = ch_versions.mix( MANIPULATE_DAMAGE.out.versions ) - ch_bams_for_library_merge = params.genotyping_source == 'rescaled' ? MANIPULATE_DAMAGE.out.rescaled : params.genotyping_source == 'pmd' ? MANIPULATE_DAMAGE.out.filtered : params.genotyping_source == 'trimmed' ? MANIPULATE_DAMAGE.out.trimmed : ch_dedupped_bams + ch_bams_for_library_merge = params.genotyping_source == 'rescaled' ? MANIPULATE_DAMAGE.out.rescaled : params.genotyping_source == 'pmd' ? MANIPULATE_DAMAGE.out.filtered : params.genotyping_source == 'trimmed' ? MANIPULATE_DAMAGE.out.trimmed : ch_merged_dedup_bams // SUBWORKFLOW: merge libraries for genotyping MERGE_LIBRARIES_GENOTYPING ( ch_bams_for_library_merge ) From d4bac3ba80e7933e691d40ae0e0ec98b6b051645 Mon Sep 17 00:00:00 2001 From: Thiseas Christos Lamnidis Date: Wed, 25 Sep 2024 16:27:27 +0200 Subject: [PATCH 04/36] fix usage for python script --- bin/collect_genotypes.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bin/collect_genotypes.py b/bin/collect_genotypes.py index 6746f499a..34a35c416 100755 --- a/bin/collect_genotypes.py +++ b/bin/collect_genotypes.py @@ -50,7 +50,7 @@ def validate_eigenstrat(genof, snpf, indf): VERSION = "1.0.0" -parser = argparse.ArgumentParser(usage="%(prog)s (-i ) (-c | -R | -E) [-L | -S Ind [-S Ind2]] [-o ]" , description="A tool to check two different EingenStrat databses for shared individuals, and extract or remove individuals from an EigenStrat database.") +parser = argparse.ArgumentParser(usage="%(prog)s [-v] (-g1 ) (-s1 ) (-i1 ) (-g2 ) (-s2 ) (-i2 ) (-o )" , description="A tool to put together two EIGENSTRAT datasets of genotyped on the same SNP set into a single dataset.") parser._optionals.title = "Available options" parser.add_argument("-g1", "--genoFn1", type = str, metavar = "", required = True, help = "The path to the input geno file of the first dataset.") parser.add_argument("-s1", "--snpFn1", type = str, metavar = "", required = True, help = "The path to the input snp file of the first dataset.") From 77d0b93910009659baac5acd92d935fd50629b32 Mon Sep 17 00:00:00 2001 From: Shyamsundar Ravishankar Date: Fri, 27 Sep 2024 20:06:47 +0930 Subject: [PATCH 05/36] Update map.nf using sharded reads --- subworkflows/local/map.nf | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/subworkflows/local/map.nf b/subworkflows/local/map.nf index 10972a2a7..cbd4e20f9 100644 --- a/subworkflows/local/map.nf +++ b/subworkflows/local/map.nf @@ -66,7 +66,7 @@ workflow MAP { if ( params.mapping_tool == 'bwaaln' ) { ch_index_for_mapping = index.map{ meta, index, fasta -> [ meta, index ] } - ch_reads_for_mapping = reads + ch_reads_for_mapping = ch_input_for_mapping.reads FASTQ_ALIGN_BWAALN ( ch_reads_for_mapping, ch_index_for_mapping ) ch_versions = ch_versions.mix ( FASTQ_ALIGN_BWAALN.out.versions.first() ) @@ -81,7 +81,7 @@ workflow MAP { ch_mapped_lane_bai = params.fasta_largeref ? FASTQ_ALIGN_BWAALN.out.csi : FASTQ_ALIGN_BWAALN.out.bai } else if ( params.mapping_tool == 'bwamem' ) { - ch_input_for_mapping = reads + ch_input_for_mapping = ch_input_for_mapping.reads .combine( index ) .multiMap { meta, reads, meta2, index, fasta -> @@ -100,7 +100,7 @@ workflow MAP { ch_mapped_lane_bai = params.fasta_largeref ? SAMTOOLS_INDEX_MEM.out.csi : SAMTOOLS_INDEX_MEM.out.bai } else if ( params.mapping_tool == 'bowtie2' ) { - ch_input_for_mapping = reads + ch_input_for_mapping = ch_input_for_mapping.reads .combine( index.map{ meta, index, fasta -> [ meta, index ] } ) .multiMap { meta, reads, meta2, index -> @@ -124,7 +124,7 @@ workflow MAP { [ meta, elongated_index ] } - CIRCULARMAPPER( index, ch_elongated_reference_for_mapping, elongated_chr_list, reads, params.fasta_circularmapper_elongationfactor ) + CIRCULARMAPPER( index, ch_elongated_reference_for_mapping, elongated_chr_list, ch_input_for_mapping.reads, params.fasta_circularmapper_elongationfactor ) ch_versions = ch_versions.mix ( CIRCULARMAPPER.out.versions ) ch_mapped_lane_bam = CIRCULARMAPPER.out.bam ch_mapped_lane_bai = CIRCULARMAPPER.out.bai // [ [ meta ], bai/csi ] From 87cfe336effa1d4b4b1797f8cd6945131a22ece0 Mon Sep 17 00:00:00 2001 From: Thiseas Christos Lamnidis Date: Fri, 4 Oct 2024 11:49:47 +0200 Subject: [PATCH 06/36] add previously ignored nf-test files. fix gitignore --- .gitignore | 2 - .../nf-core/adapterremoval/tests/main.nf.test | 120 +++ .../adapterremoval/tests/main.nf.test.snap | 124 +++ modules/nf-core/adapterremoval/tests/tags.yml | 2 + .../nf-core/angsd/gl/tests/config_gl_1.conf | 5 + .../nf-core/angsd/gl/tests/config_gl_2.conf | 6 + .../nf-core/angsd/gl/tests/config_gl_3.conf | 6 + .../nf-core/angsd/gl/tests/config_gl_4.conf | 5 + modules/nf-core/angsd/gl/tests/main.nf.test | 245 ++++++ .../nf-core/angsd/gl/tests/main.nf.test.snap | 282 +++++++ modules/nf-core/angsd/gl/tests/tags.yml | 2 + .../bedtools/coverage/tests/main.nf.test | 58 ++ .../bedtools/coverage/tests/main.nf.test.snap | 64 ++ .../bedtools/coverage/tests/nextflow.config | 7 + .../nf-core/bedtools/coverage/tests/tags.yml | 2 + .../bowtie2/align/tests/large_index.config | 5 + .../nf-core/bowtie2/align/tests/main.nf.test | 561 ++++++++++++++ .../bowtie2/align/tests/main.nf.test.snap | 263 +++++++ .../nf-core/bowtie2/align/tests/sam.config | 5 + .../nf-core/bowtie2/align/tests/sam2.config | 5 + modules/nf-core/bowtie2/align/tests/tags.yml | 2 + .../nf-core/bowtie2/build/tests/main.nf.test | 31 + .../bowtie2/build/tests/main.nf.test.snap | 45 ++ modules/nf-core/bowtie2/build/tests/tags.yml | 2 + modules/nf-core/bwa/aln/tests/main.nf.test | 90 +++ .../nf-core/bwa/aln/tests/main.nf.test.snap | 70 ++ modules/nf-core/bwa/aln/tests/tags.yml | 3 + modules/nf-core/bwa/index/tests/main.nf.test | 33 + .../nf-core/bwa/index/tests/main.nf.test.snap | 43 ++ modules/nf-core/bwa/index/tests/tags.yml | 2 + modules/nf-core/bwa/mem/tests/main.nf.test | 173 +++++ .../nf-core/bwa/mem/tests/main.nf.test.snap | 126 +++ modules/nf-core/bwa/mem/tests/tags.yml | 3 + modules/nf-core/bwa/sampe/tests/main.nf.test | 73 ++ .../nf-core/bwa/sampe/tests/main.nf.test.snap | 21 + modules/nf-core/bwa/sampe/tests/tags.yml | 4 + modules/nf-core/bwa/samse/tests/main.nf.test | 67 ++ .../nf-core/bwa/samse/tests/main.nf.test.snap | 21 + modules/nf-core/bwa/samse/tests/tags.yml | 4 + modules/nf-core/cat/fastq/tests/main.nf.test | 138 ++++ .../nf-core/cat/fastq/tests/main.nf.test.snap | 169 ++++ modules/nf-core/cat/fastq/tests/tags.yml | 2 + modules/nf-core/fastp/tests/main.nf.test | 723 ++++++++++++++++++ modules/nf-core/fastp/tests/main.nf.test.snap | 330 ++++++++ modules/nf-core/fastp/tests/nextflow.config | 6 + modules/nf-core/fastp/tests/tags.yml | 2 + modules/nf-core/freebayes/tests/main.nf.test | 179 +++++ .../nf-core/freebayes/tests/main.nf.test.snap | 48 ++ modules/nf-core/freebayes/tests/tags.yml | 2 + .../gatk4/haplotypecaller/tests/main.nf.test | 142 ++++ .../haplotypecaller/tests/main.nf.test.snap | 82 ++ .../gatk4/haplotypecaller/tests/tags.yml | 2 + modules/nf-core/gunzip/tests/main.nf.test | 36 + .../nf-core/gunzip/tests/main.nf.test.snap | 31 + modules/nf-core/gunzip/tests/tags.yml | 2 + .../picard/markduplicates/tests/main.nf.test | 104 +++ .../markduplicates/tests/main.nf.test.snap | 74 ++ .../markduplicates/tests/nextflow.config | 6 + .../picard/markduplicates/tests/tags.yml | 2 + .../preseq/lcextrap/tests/main.nf.test | 54 ++ .../preseq/lcextrap/tests/main.nf.test.snap | 58 ++ .../nf-core/preseq/lcextrap/tests/tags.yml | 2 + .../nf-core/qualimap/bamqc/tests/main.nf.test | 39 + .../qualimap/bamqc/tests/main.nf.test.snap | 16 + modules/nf-core/qualimap/bamqc/tests/tags.yml | 2 + .../nf-core/samtools/fastq/tests/main.nf.test | 70 ++ .../samtools/fastq/tests/main.nf.test.snap | 59 ++ modules/nf-core/samtools/fastq/tests/tags.yml | 2 + .../samtools/flagstat/tests/main.nf.test | 36 + .../samtools/flagstat/tests/main.nf.test.snap | 16 + .../nf-core/samtools/flagstat/tests/tags.yml | 2 + .../samtools/idxstats/tests/main.nf.test | 36 + .../samtools/idxstats/tests/main.nf.test.snap | 16 + .../nf-core/samtools/idxstats/tests/tags.yml | 2 + .../samtools/index/tests/csi.nextflow.config | 7 + .../nf-core/samtools/index/tests/main.nf.test | 87 +++ .../samtools/index/tests/main.nf.test.snap | 28 + modules/nf-core/samtools/index/tests/tags.yml | 2 + .../nf-core/samtools/merge/tests/index.config | 3 + .../nf-core/samtools/merge/tests/main.nf.test | 156 ++++ .../samtools/merge/tests/main.nf.test.snap | 68 ++ modules/nf-core/samtools/merge/tests/tags.yml | 2 + .../samtools/mpileup/tests/main.nf.test | 66 ++ .../samtools/mpileup/tests/main.nf.test.snap | 36 + .../nf-core/samtools/mpileup/tests/tags.yml | 2 + .../nf-core/samtools/sort/tests/main.nf.test | 73 ++ .../samtools/sort/tests/main.nf.test.snap | 48 ++ .../samtools/sort/tests/nextflow.config | 7 + modules/nf-core/samtools/sort/tests/tags.yml | 3 + .../nf-core/samtools/view/tests/bam.config | 3 + .../samtools/view/tests/bam_index.config | 3 + .../nf-core/samtools/view/tests/main.nf.test | 231 ++++++ .../samtools/view/tests/main.nf.test.snap | 140 ++++ modules/nf-core/samtools/view/tests/tags.yml | 2 + 94 files changed, 6037 insertions(+), 2 deletions(-) create mode 100644 modules/nf-core/adapterremoval/tests/main.nf.test create mode 100644 modules/nf-core/adapterremoval/tests/main.nf.test.snap create mode 100644 modules/nf-core/adapterremoval/tests/tags.yml create mode 100644 modules/nf-core/angsd/gl/tests/config_gl_1.conf create mode 100644 modules/nf-core/angsd/gl/tests/config_gl_2.conf create mode 100644 modules/nf-core/angsd/gl/tests/config_gl_3.conf create mode 100644 modules/nf-core/angsd/gl/tests/config_gl_4.conf create mode 100644 modules/nf-core/angsd/gl/tests/main.nf.test create mode 100644 modules/nf-core/angsd/gl/tests/main.nf.test.snap create mode 100644 modules/nf-core/angsd/gl/tests/tags.yml create mode 100644 modules/nf-core/bedtools/coverage/tests/main.nf.test create mode 100644 modules/nf-core/bedtools/coverage/tests/main.nf.test.snap create mode 100644 modules/nf-core/bedtools/coverage/tests/nextflow.config create mode 100644 modules/nf-core/bedtools/coverage/tests/tags.yml create mode 100644 modules/nf-core/bowtie2/align/tests/large_index.config create mode 100644 modules/nf-core/bowtie2/align/tests/main.nf.test create mode 100644 modules/nf-core/bowtie2/align/tests/main.nf.test.snap create mode 100644 modules/nf-core/bowtie2/align/tests/sam.config create mode 100644 modules/nf-core/bowtie2/align/tests/sam2.config create mode 100644 modules/nf-core/bowtie2/align/tests/tags.yml create mode 100644 modules/nf-core/bowtie2/build/tests/main.nf.test create mode 100644 modules/nf-core/bowtie2/build/tests/main.nf.test.snap create mode 100644 modules/nf-core/bowtie2/build/tests/tags.yml create mode 100644 modules/nf-core/bwa/aln/tests/main.nf.test create mode 100644 modules/nf-core/bwa/aln/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwa/aln/tests/tags.yml create mode 100644 modules/nf-core/bwa/index/tests/main.nf.test create mode 100644 modules/nf-core/bwa/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwa/index/tests/tags.yml create mode 100644 modules/nf-core/bwa/mem/tests/main.nf.test create mode 100644 modules/nf-core/bwa/mem/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwa/mem/tests/tags.yml create mode 100644 modules/nf-core/bwa/sampe/tests/main.nf.test create mode 100644 modules/nf-core/bwa/sampe/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwa/sampe/tests/tags.yml create mode 100644 modules/nf-core/bwa/samse/tests/main.nf.test create mode 100644 modules/nf-core/bwa/samse/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwa/samse/tests/tags.yml create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test.snap create mode 100644 modules/nf-core/cat/fastq/tests/tags.yml create mode 100644 modules/nf-core/fastp/tests/main.nf.test create mode 100644 modules/nf-core/fastp/tests/main.nf.test.snap create mode 100644 modules/nf-core/fastp/tests/nextflow.config create mode 100644 modules/nf-core/fastp/tests/tags.yml create mode 100644 modules/nf-core/freebayes/tests/main.nf.test create mode 100644 modules/nf-core/freebayes/tests/main.nf.test.snap create mode 100644 modules/nf-core/freebayes/tests/tags.yml create mode 100644 modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test create mode 100644 modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap create mode 100644 modules/nf-core/gatk4/haplotypecaller/tests/tags.yml create mode 100644 modules/nf-core/gunzip/tests/main.nf.test create mode 100644 modules/nf-core/gunzip/tests/main.nf.test.snap create mode 100644 modules/nf-core/gunzip/tests/tags.yml create mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test create mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test.snap create mode 100644 modules/nf-core/picard/markduplicates/tests/nextflow.config create mode 100644 modules/nf-core/picard/markduplicates/tests/tags.yml create mode 100644 modules/nf-core/preseq/lcextrap/tests/main.nf.test create mode 100644 modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap create mode 100644 modules/nf-core/preseq/lcextrap/tests/tags.yml create mode 100644 modules/nf-core/qualimap/bamqc/tests/main.nf.test create mode 100644 modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap create mode 100644 modules/nf-core/qualimap/bamqc/tests/tags.yml create mode 100644 modules/nf-core/samtools/fastq/tests/main.nf.test create mode 100644 modules/nf-core/samtools/fastq/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/fastq/tests/tags.yml create mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test create mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/flagstat/tests/tags.yml create mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test create mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/idxstats/tests/tags.yml create mode 100644 modules/nf-core/samtools/index/tests/csi.nextflow.config create mode 100644 modules/nf-core/samtools/index/tests/main.nf.test create mode 100644 modules/nf-core/samtools/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/index/tests/tags.yml create mode 100644 modules/nf-core/samtools/merge/tests/index.config create mode 100644 modules/nf-core/samtools/merge/tests/main.nf.test create mode 100644 modules/nf-core/samtools/merge/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/merge/tests/tags.yml create mode 100644 modules/nf-core/samtools/mpileup/tests/main.nf.test create mode 100644 modules/nf-core/samtools/mpileup/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/mpileup/tests/tags.yml create mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test create mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/sort/tests/nextflow.config create mode 100644 modules/nf-core/samtools/sort/tests/tags.yml create mode 100644 modules/nf-core/samtools/view/tests/bam.config create mode 100644 modules/nf-core/samtools/view/tests/bam_index.config create mode 100644 modules/nf-core/samtools/view/tests/main.nf.test create mode 100644 modules/nf-core/samtools/view/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/view/tests/tags.yml diff --git a/.gitignore b/.gitignore index f982169a0..5124c9ac7 100644 --- a/.gitignore +++ b/.gitignore @@ -6,5 +6,3 @@ results/ testing/ testing* *.pyc -tests/ -test/ diff --git a/modules/nf-core/adapterremoval/tests/main.nf.test b/modules/nf-core/adapterremoval/tests/main.nf.test new file mode 100644 index 000000000..91c07b7ee --- /dev/null +++ b/modules/nf-core/adapterremoval/tests/main.nf.test @@ -0,0 +1,120 @@ +nextflow_process { + + name "Test Process ADAPTERREMOVAL" + script "../main.nf" + process "ADAPTERREMOVAL" + + tag "modules" + tag "modules_nfcore" + tag "adapterremoval" + + test("single-end - sarscov2 - [fastq]") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true, collapse:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.singles_truncated, + process.out.settings, + process.out.versions).match() }, + ) + } + } + + test("paired-end - sarscov2 - [fastq]") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false, collapse:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.paired_truncated, + process.out.settings, + process.out.versions).match() }, + { assert process.out.discarded } + ) + } + + } + + test("paired-end collapse - sarscov2 - [fastq]") { + + options "--collapse" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.paired_truncated, + process.out.collapsed, + process.out.settings, + process.out.versions).match() }, + { assert process.out.discarded } + ) + } + + } + + test("paired-end adapterlist - sarscov2 - [fastq]") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false, collapse:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/adapterremoval/adapterremoval_adapterlist.txt", + checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.paired_truncated, + process.out.settings, + process.out.versions).match() }, + { assert process.out.discarded } + ) + } + + } + +} diff --git a/modules/nf-core/adapterremoval/tests/main.nf.test.snap b/modules/nf-core/adapterremoval/tests/main.nf.test.snap new file mode 100644 index 000000000..f890167a9 --- /dev/null +++ b/modules/nf-core/adapterremoval/tests/main.nf.test.snap @@ -0,0 +1,124 @@ +{ + "single-end - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true, + "collapse": false + }, + "test.truncated.fastq.gz:md5,119d1b1a0a71ca6e080ff7c53ee0b690" + ] + ], + [ + [ + { + "id": "test", + "single_end": true, + "collapse": false + }, + "test.settings:md5,2fd3d5d703b63ba33a83021fccf25f77" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:36.429445996" + }, + "paired-end - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + [ + "test.pair1.truncated.fastq.gz:md5,e3da014fbb9b428e952c62e8f0fb6402", + "test.pair2.truncated.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + "test.settings:md5,b8a451d3981b327f3fdb44f40ba2d6d1" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:42.88672676" + }, + "paired-end collapse - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.pair1.truncated.fastq.gz:md5,e3da014fbb9b428e952c62e8f0fb6402", + "test.pair2.truncated.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.settings:md5,b8a451d3981b327f3fdb44f40ba2d6d1" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:49.299792876" + }, + "paired-end adapterlist - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + [ + "test.pair1.truncated.fastq.gz:md5,e3da014fbb9b428e952c62e8f0fb6402", + "test.pair2.truncated.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + "test.settings:md5,36d47d9b40dbc178167d1ae0274d18f3" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:57.26567964" + } +} \ No newline at end of file diff --git a/modules/nf-core/adapterremoval/tests/tags.yml b/modules/nf-core/adapterremoval/tests/tags.yml new file mode 100644 index 000000000..d3375ec50 --- /dev/null +++ b/modules/nf-core/adapterremoval/tests/tags.yml @@ -0,0 +1,2 @@ +adapterremoval: + - "modules/nf-core/adapterremoval/**" diff --git a/modules/nf-core/angsd/gl/tests/config_gl_1.conf b/modules/nf-core/angsd/gl/tests/config_gl_1.conf new file mode 100644 index 000000000..f45e3a4a6 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_1.conf @@ -0,0 +1,5 @@ +process { + withName: ANGSD_GL { + ext.args = '-GL 1 -doGlf 1' + } +} diff --git a/modules/nf-core/angsd/gl/tests/config_gl_2.conf b/modules/nf-core/angsd/gl/tests/config_gl_2.conf new file mode 100644 index 000000000..f54bd748e --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_2.conf @@ -0,0 +1,6 @@ +process { + withName: ANGSD_GL { + // -doMajorMinor is needed for -doGlf 2 + ext.args = '-GL 2 -doGlf 2 -doMajorMinor 1' + } +} diff --git a/modules/nf-core/angsd/gl/tests/config_gl_3.conf b/modules/nf-core/angsd/gl/tests/config_gl_3.conf new file mode 100644 index 000000000..ccfd5dcaf --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_3.conf @@ -0,0 +1,6 @@ +process { + withName: ANGSD_GL { + // -doMajorMinor is needed for -doGlf 3 + ext.args = '-GL 3 -doGlf 3 -doMajorMinor 1' + } +} diff --git a/modules/nf-core/angsd/gl/tests/config_gl_4.conf b/modules/nf-core/angsd/gl/tests/config_gl_4.conf new file mode 100644 index 000000000..fc9622d57 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_4.conf @@ -0,0 +1,5 @@ +process { + withName: ANGSD_GL { + ext.args = '-GL 4 -doGlf 4' + } +} diff --git a/modules/nf-core/angsd/gl/tests/main.nf.test b/modules/nf-core/angsd/gl/tests/main.nf.test new file mode 100644 index 000000000..412f46a53 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/main.nf.test @@ -0,0 +1,245 @@ +// nf-core modules test angsd/gl +nextflow_process { + + name "Test Process ANGSD_GL" + script "../main.nf" + process "ANGSD_GL" + + tag "modules" + tag "modules_nfcore" + tag "angsd" + tag "angsd/gl" + + test("angsd - gl_samtools - bam") { + + when { + config "./config_gl_1.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_gatk - bam") { + + when { + config "./config_gl_2.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_soapsnp - bam") { + + when { + config "./config_gl_3.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_syk - bam") { + + when { + config "./config_gl_4.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_samtools - bam - stub") { + + options "-stub" + + when { + config "./config_gl_1.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_gatk - bam - stub") { + + options "-stub" + + when { + config "./config_gl_2.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_soapsnp - bam - stub") { + + options "-stub" + + when { + config "./config_gl_3.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_syk - bam - stub") { + + options "-stub" + + when { + config "./config_gl_4.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/angsd/gl/tests/main.nf.test.snap b/modules/nf-core/angsd/gl/tests/main.nf.test.snap new file mode 100644 index 000000000..9128813e1 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/main.nf.test.snap @@ -0,0 +1,282 @@ +{ + "angsd - gl_samtools - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,b1cafc93095fae26e476e6e253a7615c" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,b1cafc93095fae26e476e6e253a7615c" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:23:37.916689" + }, + "angsd - gl_gatk - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:26:28.489425" + }, + "angsd - gl_samtools - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:26:04.586755" + }, + "angsd - gl_soapsnp - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,6d5bc2aa4b5276781960813c12552600" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,6d5bc2aa4b5276781960813c12552600" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:25:09.666904" + }, + "angsd - gl_syk - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:27:16.099902" + }, + "angsd - gl_syk - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,ce3a9b56a2692316f2bd632980c53a7c" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,ce3a9b56a2692316f2bd632980c53a7c" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:25:39.786421" + }, + "angsd - gl_soapsnp - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:26:52.996405" + }, + "angsd - gl_gatk - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.beagle.gz:md5,424369dc4c67227624cb39f3cc96eb58" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.beagle.gz:md5,424369dc4c67227624cb39f3cc96eb58" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:23:58.730987" + } +} \ No newline at end of file diff --git a/modules/nf-core/angsd/gl/tests/tags.yml b/modules/nf-core/angsd/gl/tests/tags.yml new file mode 100644 index 000000000..137fda1c2 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/tags.yml @@ -0,0 +1,2 @@ +angsd/gl: + - "modules/nf-core/angsd/gl/**" diff --git a/modules/nf-core/bedtools/coverage/tests/main.nf.test b/modules/nf-core/bedtools/coverage/tests/main.nf.test new file mode 100644 index 000000000..b9db30425 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/main.nf.test @@ -0,0 +1,58 @@ +nextflow_process { + name "Test Process BEDTOOLS_COVERAGE" + script "../main.nf" + process "BEDTOOLS_COVERAGE" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/coverage" + + test("sarscov2") { + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fai") { + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bedtools/coverage/tests/main.nf.test.snap b/modules/nf-core/bedtools/coverage/tests/main.nf.test.snap new file mode 100644 index 000000000..22f575389 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/main.nf.test.snap @@ -0,0 +1,64 @@ +{ + "sarscov2": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "1": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "versions": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ] + } + ], + "timestamp": "2023-12-05T17:37:06.311531" + }, + "sarscov2 - fai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "1": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "versions": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ] + } + ], + "timestamp": "2023-12-05T17:37:14.228196" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/coverage/tests/nextflow.config b/modules/nf-core/bedtools/coverage/tests/nextflow.config new file mode 100644 index 000000000..ea1db46e2 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: BEDTOOLS_COVERAGE { + ext.prefix = { "${meta.id}.coverage" } + } + +} diff --git a/modules/nf-core/bedtools/coverage/tests/tags.yml b/modules/nf-core/bedtools/coverage/tests/tags.yml new file mode 100644 index 000000000..e9764bf01 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/coverage: + - "modules/nf-core/bedtools/coverage/**" diff --git a/modules/nf-core/bowtie2/align/tests/large_index.config b/modules/nf-core/bowtie2/align/tests/large_index.config new file mode 100644 index 000000000..fdc1c59dd --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/large_index.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_BUILD { + ext.args = '--large-index' + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test b/modules/nf-core/bowtie2/align/tests/main.nf.test new file mode 100644 index 000000000..a478d17b5 --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test @@ -0,0 +1,561 @@ +nextflow_process { + + name "Test Process BOWTIE2_ALIGN" + script "../main.nf" + process "BOWTIE2_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/align" + + test("sarscov2 - fastq, index, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, false - sam") { + + config "./sam.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, false - sam2") { + + config "./sam2.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, large_index, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], large_index, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, true, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + file(process.out.log[0][1]).name, + file(process.out.fastq[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test.snap b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap new file mode 100644 index 000000000..883dc7ecb --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap @@ -0,0 +1,263 @@ +{ + "sarscov2 - fastq, index, false, false - sam2": { + "content": [ + [ + "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAA12.922000 K (92.984097%)", + "single end (151 cycles)" ] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end") } + ) + } + } + + test("test_fastp_single_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end_stub") } + ) + } + } + + test("test_fastp_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end") } + ) + } + } + + test("test_fastp_paired_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end-stub") } + ) + } + } + + test("fastp test_fastp_interleaved") { + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "paired end (151 cycles + 151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 198"] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved") } + ) + } + } + + test("fastp test_fastp_interleaved-stub") { + + options '-stub' + + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved-stub") } + ) + } + } + + test("test_fastp_single_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { failed_read_lines.each { failed_read_line -> + { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { failed_read2_lines.each { failed_read2_line -> + { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] + def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged") } + ) + } + } + + test("test_fastp_paired_end_merged-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") } + ) + } + } + + test("test_fastp_paired_end_merged_adapterlist") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + save_trimmed_fail = false + save_merged = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] + def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") } + ) + } + } +} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap new file mode 100644 index 000000000..b4c0e1dd8 --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -0,0 +1,330 @@ +{ + "fastp test_fastp_interleaved_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.123035" + }, + "test_fastp_paired_end_merged-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:10:13.467574" + }, + "versions_interleaved": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:24.615634793" + }, + "test_fastp_single_end_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.223817" + }, + "versions_paired_end": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:42.333545689" + }, + "test_fastp_paired_end_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:03:06.431833729" + }, + "test_fastp_interleaved-_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:03:37.827323085" + }, + "test_fastp_paired_end_merged_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:08:44.496251446" + }, + "versions_single_end_stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:27.354051299" + }, + "versions_interleaved-stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:46.535528418" + }, + "versions_single_end_trim_fail": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:03.724591407" + }, + "test_fastp_paired_end-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:07:15.398827" + }, + "versions_paired_end-stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:06.50017282" + }, + "versions_single_end": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:07.67921647" + }, + "versions_paired_end_merged_stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:47.350653154" + }, + "test_fastp_interleaved-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.127974" + }, + "versions_paired_end_trim_fail": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:18.140484878" + }, + "test_fastp_single_end-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.244202" + }, + "test_fastp_single_end-_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:57:30.791982648" + }, + "versions_paired_end_merged_adapterlist": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:05:37.845370554" + }, + "versions_paired_end_merged": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:32.860543858" + }, + "test_fastp_single_end_trim_fail_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:41.942317" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config new file mode 100644 index 000000000..0f7849ad9 --- /dev/null +++ b/modules/nf-core/fastp/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + + withName: FASTP { + ext.args = "--interleaved_in" + } +} diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml new file mode 100644 index 000000000..c1afcce75 --- /dev/null +++ b/modules/nf-core/fastp/tests/tags.yml @@ -0,0 +1,2 @@ +fastp: + - modules/nf-core/fastp/** diff --git a/modules/nf-core/freebayes/tests/main.nf.test b/modules/nf-core/freebayes/tests/main.nf.test new file mode 100644 index 000000000..bee25a8e7 --- /dev/null +++ b/modules/nf-core/freebayes/tests/main.nf.test @@ -0,0 +1,179 @@ +nextflow_process { + + name "Test Process FREEBAYES" + script "../main.nf" + process "FREEBAYES" + + tag "modules" + tag "modules_nfcore" + tag "freebayes" + + test("sarscov2 - [ bam, bai ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + [], + [] + ] + input[1] = [ [ id: 'test_fasta' ], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'test_fai' ], file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains('MT192765.1\t10214\t.\tATTTAC\tATTAC\t29.8242') }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ bam, bai, bed ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + [], + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true), + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ cram, crai ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + [], + [], + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains("chr22\t1982\t.\tA\tG\t459.724") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ bam, bai, bam, bai ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains("chr22\t1982\t.\tA\tG\t670.615") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ cram, crai, cram, crai, bed ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram_crai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true), + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains("chr22\t1982\t.\tA\tG\t670.615") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } +} diff --git a/modules/nf-core/freebayes/tests/main.nf.test.snap b/modules/nf-core/freebayes/tests/main.nf.test.snap new file mode 100644 index 000000000..9760a680e --- /dev/null +++ b/modules/nf-core/freebayes/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "sarscov2 - [ cram, crai, cram, crai, bed ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:20:01.263906" + }, + "sarscov2 - [ bam, bai ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:37.06375" + }, + "test.vcf.gz": { + "content": [ + "test.vcf.gz" + ], + "timestamp": "2023-12-13T12:19:37.050165" + }, + "sarscov2 - [ cram, crai ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:48.797103" + }, + "sarscov2 - [ bam, bai, bed ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:43.147912" + }, + "sarscov2 - [ bam, bai, bam, bai ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:55.186773" + } +} \ No newline at end of file diff --git a/modules/nf-core/freebayes/tests/tags.yml b/modules/nf-core/freebayes/tests/tags.yml new file mode 100644 index 000000000..5563fb326 --- /dev/null +++ b/modules/nf-core/freebayes/tests/tags.yml @@ -0,0 +1,2 @@ +freebayes: + - "modules/nf-core/freebayes/**" diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test new file mode 100644 index 000000000..a124bff53 --- /dev/null +++ b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test @@ -0,0 +1,142 @@ +// nf-core modules test gatk4/haplotypecaller +nextflow_process { + + name "Test Process GATK4_HAPLOTYPECALLER" + script "../main.nf" + process "GATK4_HAPLOTYPECALLER" + + tag "modules" + tag "modules_nfcore" + tag "gatk4" + tag "gatk4/haplotypecaller" + + test("homo_sapiens - [bam, bai] - fasta - fai - dict") { + + when { + process { + """ + input[0] = [ + [ id:'test_bam' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + [] + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_bam_input") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_bam_input") }, + ) + } + + } + + test("homo_sapiens - [cram, crai] - fasta - fai - dict") { + + when { + process { + """ + input[0] = [ + [ id:'test_cram' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + [] + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_cram_input") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_cram_input") }, + ) + } + + } + + test("homo_sapiens - [cram, crai] - fasta - fai - dict - sites - sites_tbi") { + + when { + process { + """ + input[0] = [ + [ id:'test_cram_sites' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + [] + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [ id:'test_sites' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz'], checkIfExists: true) ] + input[5] = [ [ id:'test_sites_tbi' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz_tbi'], checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_cram_input_with_sites") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_cram_input_with_sites") }, + ) + } + + } + + test("homo_sapiens - [cram, crai, dragstr_model] - fasta - fai - dict - sites - sites_tbi") { + + when { + process { + """ + input[0] = [ + [ id:'test_cram_sites_dragstr' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_dragstrmodel'], checkIfExists: true) + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [ id:'test_sites' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz'], checkIfExists: true) ] + input[5] = [ [ id:'test_sites_tbi' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz_tbi'], checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_cram_dragstr_input_with_sites") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_cram_dragstr_input_with_sites") }, + ) + } + + } + +} diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap new file mode 100644 index 000000000..375025ee3 --- /dev/null +++ b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap @@ -0,0 +1,82 @@ +{ + "gatk_hc_vcf_cram_dragstr_input_with_sites": { + "content": [ + "test_cram_sites_dragstr.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:45.142682" + }, + "gatk_hc_vcf_bam_input": { + "content": [ + "test_bam.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:19.203837" + }, + "gatk_hc_vcf_cram_input": { + "content": [ + "test_cram.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:48.434615" + }, + "gatk_hc_vcf_cram_input_with_sites": { + "content": [ + "test_cram_sites.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:17.147745" + }, + "gatk_hc_vcf_tbi_bam_input": { + "content": [ + "test_bam.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:19.23048" + }, + "gatk_hc_vcf_tbi_cram_input": { + "content": [ + "test_cram.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:48.45958" + }, + "gatk_hc_vcf_tbi_cram_dragstr_input_with_sites": { + "content": [ + "test_cram_sites_dragstr.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:45.154818" + }, + "gatk_hc_vcf_tbi_cram_input_with_sites": { + "content": [ + "test_cram_sites.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:17.158138" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml b/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml new file mode 100644 index 000000000..d05bb6554 --- /dev/null +++ b/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml @@ -0,0 +1,2 @@ +gatk4/haplotypecaller: + - "modules/nf-core/gatk4/haplotypecaller/**" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test new file mode 100644 index 000000000..6406008ef --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -0,0 +1,36 @@ +nextflow_process { + + name "Test Process GUNZIP" + script "../main.nf" + process "GUNZIP" + tag "gunzip" + tag "modules_nfcore" + tag "modules" + + test("Should run without failures") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap new file mode 100644 index 000000000..720fd9ff4 --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -0,0 +1,31 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "timestamp": "2023-10-17T15:35:37.690477896" + } +} \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/tags.yml b/modules/nf-core/gunzip/tests/tags.yml new file mode 100644 index 000000000..fd3f69154 --- /dev/null +++ b/modules/nf-core/gunzip/tests/tags.yml @@ -0,0 +1,2 @@ +gunzip: + - modules/nf-core/gunzip/** diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test new file mode 100644 index 000000000..c5a29b4bd --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test @@ -0,0 +1,104 @@ +nextflow_process { + + name "Test Process PICARD_MARKDUPLICATES" + script "../main.nf" + process "PICARD_MARKDUPLICATES" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "picard" + tag "picard/markduplicates" + + test("sarscov2 [unsorted bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("unsorted_bam_name") }, + { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("unsorted_bam_metrics") }, + { assert snapshot(process.out.versions).match("unsorted_bam_versions") } + ) + } + } + + test("sarscov2 [sorted bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("sorted_bam_name") }, + { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("sorted_bam_metrics") }, + { assert snapshot(process.out.versions).match("sorted_bam_versions") } + ) + } + } + + test("homo_sapiens [cram]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("cram_name") }, + { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("cram_metrics") }, + { assert snapshot(process.out.versions).match("cram_versions") } + ) + } + } +} diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap new file mode 100644 index 000000000..31c9130dc --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap @@ -0,0 +1,74 @@ +{ + "sorted_bam_versions": { + "content": [ + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2024-01-19T10:26:45.092349" + }, + "unsorted_bam_name": { + "content": [ + "test.marked.bam" + ], + "timestamp": "2024-01-19T10:26:28.100755" + }, + "cram_metrics": { + "content": [ + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ] + ], + "timestamp": "2024-01-19T10:27:03.253071" + }, + "sorted_bam_metrics": { + "content": [ + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ] + ], + "timestamp": "2024-01-19T10:26:45.086503" + }, + "cram_name": { + "content": [ + "test.marked.bam" + ], + "timestamp": "2024-01-19T10:27:03.241617" + }, + "cram_versions": { + "content": [ + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2024-01-19T10:27:03.26989" + }, + "unsorted_bam_versions": { + "content": [ + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2024-01-19T10:26:28.159071" + }, + "unsorted_bam_metrics": { + "content": [ + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ] + ], + "timestamp": "2024-01-19T10:26:28.143979" + }, + "sorted_bam_name": { + "content": [ + "test.marked.bam" + ], + "timestamp": "2024-01-19T10:26:45.080116" + } +} \ No newline at end of file diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config new file mode 100644 index 000000000..02818dd6e --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + withName: PICARD_MARKDUPLICATES { + ext.prefix = { "${meta.id}.marked" } + ext.args = '--ASSUME_SORT_ORDER queryname' + } +} diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml new file mode 100644 index 000000000..4f213d620 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/tags.yml @@ -0,0 +1,2 @@ +picard/markduplicates: + - modules/nf-core/picard/markduplicates/** diff --git a/modules/nf-core/preseq/lcextrap/tests/main.nf.test b/modules/nf-core/preseq/lcextrap/tests/main.nf.test new file mode 100644 index 000000000..aa12bc1ab --- /dev/null +++ b/modules/nf-core/preseq/lcextrap/tests/main.nf.test @@ -0,0 +1,54 @@ +nextflow_process { + + name "Test Process PRESEQ_LCEXTRAP" + script "../main.nf" + process "PRESEQ_LCEXTRAP" + tag "modules" + tag "modules_nfcore" + tag "preseq" + tag "preseq/lcextrap" + + test("sarscov2 - single_end") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'delete_me/preseq/SRR1003759_5M_subset.mr', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log[0][1]).name).match("single_end - log") }, + { assert snapshot(process.out.lc_extrap).match("single_end - lc_extrap") }, + { assert snapshot(process.out.versions).match("single_end - versions") } + ) + } + } + + test("sarscov2 - paired_end") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'delete_me/preseq/SRR1003759_5M_subset.mr', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log[0][1]).name).match("paired_end - log") }, + { assert snapshot(process.out.lc_extrap).match("paired_end - lc_extrap") }, + { assert snapshot(process.out.versions).match("paired_end - versions") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap b/modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap new file mode 100644 index 000000000..c59dea7fe --- /dev/null +++ b/modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap @@ -0,0 +1,58 @@ +{ + "single_end - lc_extrap": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.lc_extrap.txt:md5,1fa5cdd601079329618f61660bee00de" + ] + ] + ], + "timestamp": "2023-11-23T17:20:40.735535" + }, + "paired_end - log": { + "content": [ + "test.command.log" + ], + "timestamp": "2023-11-23T17:20:51.981746" + }, + "single_end - versions": { + "content": [ + [ + "versions.yml:md5,9a62ff1c212c53573808ccd2137b8922" + ] + ], + "timestamp": "2023-11-23T17:20:40.74601" + }, + "paired_end - versions": { + "content": [ + [ + "versions.yml:md5,9a62ff1c212c53573808ccd2137b8922" + ] + ], + "timestamp": "2023-11-23T17:20:52.02843" + }, + "single_end - log": { + "content": [ + "test.command.log" + ], + "timestamp": "2023-11-23T17:20:40.72985" + }, + "paired_end - lc_extrap": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.lc_extrap.txt:md5,10e5ea860e87fb6f5dc10f4f20c62040" + ] + ] + ], + "timestamp": "2023-11-23T17:20:51.998533" + } +} \ No newline at end of file diff --git a/modules/nf-core/preseq/lcextrap/tests/tags.yml b/modules/nf-core/preseq/lcextrap/tests/tags.yml new file mode 100644 index 000000000..b9e25ea71 --- /dev/null +++ b/modules/nf-core/preseq/lcextrap/tests/tags.yml @@ -0,0 +1,2 @@ +preseq/lcextrap: + - modules/nf-core/preseq/lcextrap/** diff --git a/modules/nf-core/qualimap/bamqc/tests/main.nf.test b/modules/nf-core/qualimap/bamqc/tests/main.nf.test new file mode 100644 index 000000000..ba2260cae --- /dev/null +++ b/modules/nf-core/qualimap/bamqc/tests/main.nf.test @@ -0,0 +1,39 @@ +nextflow_process { + + name "Test Process QUALIMAP_BAMQC" + script "../main.nf" + process "QUALIMAP_BAMQC" + tag "modules" + tag "modules_nfcore" + tag "qualimap" + tag "qualimap/bamqc" + + test("homo_sapiens [bam]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + gff = [] + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = gff + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert path("${process.out.results[0][1]}/qualimapReport.html").exists() }, + { assert snapshot(path("${process.out.results[0][1]}/genome_results.txt")).match("genome_results") }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap b/modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap new file mode 100644 index 000000000..25148df2b --- /dev/null +++ b/modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "genome_results": { + "content": [ + "genome_results.txt:md5,45103d63ba82df2b905eb04819c32dd3" + ], + "timestamp": "2024-01-19T12:05:00.122103" + }, + "versions": { + "content": [ + [ + "versions.yml:md5,9024d7d0a189d8be1485249ae591b907" + ] + ], + "timestamp": "2024-01-19T12:05:00.131485" + } +} diff --git a/modules/nf-core/qualimap/bamqc/tests/tags.yml b/modules/nf-core/qualimap/bamqc/tests/tags.yml new file mode 100644 index 000000000..b2b5eb6fc --- /dev/null +++ b/modules/nf-core/qualimap/bamqc/tests/tags.yml @@ -0,0 +1,2 @@ +qualimap/bamqc: + - modules/nf-core/qualimap/bamqc/** diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test b/modules/nf-core/samtools/fastq/tests/main.nf.test new file mode 100644 index 000000000..8280c5449 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test @@ -0,0 +1,70 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FASTQ" + script "../main.nf" + process "SAMTOOLS_FASTQ" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/fastq" + + test("sarscov2 - bam, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.fastq[0][1].collect { path(it).linesGzip[0..6] }, + process.out.interleaved, + file(process.out.singleton[0][1]).name, + file(process.out.other[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, true") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.fastq, + path(process.out.interleaved[0][1]).readLines()[0..6], + process.out.singleton, + file(process.out.other[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test.snap b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap new file mode 100644 index 000000000..70fd21790 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap @@ -0,0 +1,59 @@ +{ + "sarscov2 - bam, true": { + "content": [ + [ + + ], + [ + "@ERR5069949.2151832/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "+", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE Date: Tue, 8 Oct 2024 12:30:05 +0000 Subject: [PATCH 07/36] Template update for nf-core/tools version 3.0.0 --- .editorconfig | 4 + .github/CONTRIBUTING.md | 10 +- .github/PULL_REQUEST_TEMPLATE.md | 2 +- .github/workflows/awsfulltest.yml | 23 +- .github/workflows/ci.yml | 17 +- .github/workflows/download_pipeline.yml | 53 ++- .github/workflows/linting.yml | 23 +- .github/workflows/linting_comment.yml | 2 +- .github/workflows/release-announcements.yml | 2 +- .../workflows/template_version_comment.yml | 43 ++ .gitpod.yml | 7 +- .nf-core.yml | 19 +- .pre-commit-config.yaml | 2 +- .prettierignore | 1 + CITATIONS.md | 4 +- README.md | 5 +- assets/schema_input.json | 2 +- conf/base.config | 34 +- conf/igenomes_ignored.config | 9 + conf/modules.config | 1 - conf/test.config | 13 +- docs/images/mqc_fastqc_adapter.png | Bin 23458 -> 0 bytes docs/images/mqc_fastqc_counts.png | Bin 33918 -> 0 bytes docs/images/mqc_fastqc_quality.png | Bin 55769 -> 0 bytes docs/output.md | 11 +- docs/usage.md | 12 +- main.nf | 10 +- modules.json | 12 +- modules/nf-core/fastqc/environment.yml | 2 - modules/nf-core/fastqc/main.nf | 5 +- modules/nf-core/fastqc/meta.yml | 57 +-- modules/nf-core/fastqc/tests/main.nf.test | 225 ++++++++--- .../nf-core/fastqc/tests/main.nf.test.snap | 370 ++++++++++++++++-- modules/nf-core/multiqc/environment.yml | 4 +- modules/nf-core/multiqc/main.nf | 14 +- modules/nf-core/multiqc/meta.yml | 78 ++-- modules/nf-core/multiqc/tests/main.nf.test | 8 + .../nf-core/multiqc/tests/main.nf.test.snap | 20 +- modules/nf-core/multiqc/tests/nextflow.config | 5 + nextflow.config | 146 ++++--- nextflow_schema.json | 85 +--- .../local/utils_nfcore_eager_pipeline/main.nf | 56 +-- .../nf-core/utils_nextflow_pipeline/main.nf | 24 +- .../tests/nextflow.config | 2 +- .../nf-core/utils_nfcore_pipeline/main.nf | 45 ++- .../nf-core/utils_nfschema_plugin/main.nf | 46 +++ .../nf-core/utils_nfschema_plugin/meta.yml | 35 ++ .../utils_nfschema_plugin/tests/main.nf.test | 117 ++++++ .../tests/nextflow.config | 8 + .../tests/nextflow_schema.json | 8 +- .../nf-core/utils_nfvalidation_plugin/main.nf | 62 --- .../utils_nfvalidation_plugin/meta.yml | 44 --- .../tests/main.nf.test | 200 ---------- .../utils_nfvalidation_plugin/tests/tags.yml | 2 - workflows/eager.nf | 23 +- 55 files changed, 1206 insertions(+), 806 deletions(-) create mode 100644 .github/workflows/template_version_comment.yml create mode 100644 conf/igenomes_ignored.config delete mode 100755 docs/images/mqc_fastqc_adapter.png delete mode 100755 docs/images/mqc_fastqc_counts.png delete mode 100755 docs/images/mqc_fastqc_quality.png create mode 100644 modules/nf-core/multiqc/tests/nextflow.config create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/main.nf create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/meta.yml create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config rename subworkflows/nf-core/{utils_nfvalidation_plugin => utils_nfschema_plugin}/tests/nextflow_schema.json (95%) delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/main.nf delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml diff --git a/.editorconfig b/.editorconfig index 72dda289a..e10588156 100644 --- a/.editorconfig +++ b/.editorconfig @@ -11,6 +11,7 @@ indent_style = space [*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 + # These files are edited and tested upstream in nf-core/modules [/modules/nf-core/**] charset = unset @@ -25,9 +26,12 @@ insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset + + [/assets/email*] indent_size = unset + # ignore python and markdown [*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 69e685440..ad17de748 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -19,7 +19,7 @@ If you'd like to write some code for nf-core/eager, the standard workflow is as 1. Check that there isn't already an issue about your idea in the [nf-core/eager issues](https://github.com/nf-core/eager/issues) to avoid duplicating work. If there isn't one already, please create one so that others know you're working on this 2. [Fork](https://help.github.com/en/github/getting-started-with-github/fork-a-repo) the [nf-core/eager repository](https://github.com/nf-core/eager) to your GitHub account 3. Make the necessary changes / additions within your forked repository following [Pipeline conventions](#pipeline-contribution-conventions) -4. Use `nf-core schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). +4. Use `nf-core pipelines schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). 5. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged If you're not used to this workflow with git, you can start with some [docs from GitHub](https://help.github.com/en/github/collaborating-with-issues-and-pull-requests) or even their [excellent `git` resources](https://try.github.io/). @@ -40,7 +40,7 @@ There are typically two types of tests that run: ### Lint tests `nf-core` has a [set of guidelines](https://nf-co.re/developers/guidelines) which all pipelines must adhere to. -To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core lint ` command. +To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core pipelines lint ` command. If any failures or warnings are encountered, please follow the listed URL for more documentation. @@ -75,7 +75,7 @@ If you wish to contribute a new step, please use the following coding standards: 2. Write the process block (see below). 3. Define the output channel if needed (see below). 4. Add any new parameters to `nextflow.config` with a default (see below). -5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core schema build` tool). +5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core pipelines schema build` tool). 6. Add sanity checks and validation for all relevant parameters. 7. Perform local tests to validate that the new code works as expected. 8. If applicable, add a new test command in `.github/workflow/ci.yml`. @@ -86,7 +86,7 @@ If you wish to contribute a new step, please use the following coding standards: Parameters should be initialised / defined with default values in `nextflow.config` under the `params` scope. -Once there, use `nf-core schema build` to add to `nextflow_schema.json`. +Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. ### Default processes resource requirements @@ -103,7 +103,7 @@ Please use the following naming schemes, to make it easy to understand what is g ### Nextflow version bumping -If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core bump-version --nextflow . [min-nf-version]` +If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core pipelines bump-version --nextflow . [min-nf-version]` ### Images and figures diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 2a999dcee..985adf2dd 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -17,7 +17,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/eage - [ ] If you've fixed a bug or added code that should be tested, add tests! - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/eager/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/eager _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. -- [ ] Make sure your code lints (`nf-core lint`). +- [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index bac036714..d0225079a 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,18 +1,33 @@ name: nf-core AWS full size tests -# This workflow is triggered on published releases. +# This workflow is triggered on PRs opened against the master branch. # It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: - release: - types: [published] + pull_request: + branches: + - master workflow_dispatch: + pull_request_review: + types: [submitted] + jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/eager' + if: github.repository == 'nf-core/eager' && github.event.review.state == 'approved' runs-on: ubuntu-latest steps: + - uses: octokit/request-action@v2.x + id: check_approvals + with: + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.review.number }}/reviews + env: + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + - id: test_variables + run: | + JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' + CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') + test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 # TODO nf-core: You can customise AWS full pipeline tests as required diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index a4dbf1268..9917a508f 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -7,6 +7,7 @@ on: pull_request: release: types: [published] + workflow_dispatch: env: NXF_ANSI_LOG: false @@ -24,7 +25,7 @@ jobs: strategy: matrix: NXF_VER: - - "23.04.0" + - "24.04.2" - "latest-everything" steps: - name: Check out pipeline code @@ -38,9 +39,21 @@ jobs: - name: Disk space cleanup uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data + - name: Run pipeline with test data (docker) # TODO nf-core: You can customise CI pipeline run tests as required # For example: adding multiple test runs with different parameters # Remember that you can parallelise this by using strategy.matrix run: | nextflow run ${GITHUB_WORKSPACE} -profile test,docker --outdir ./results + + - name: Run pipeline with test data (singularity) + # TODO nf-core: You can customise CI pipeline run tests as required + run: | + nextflow run ${GITHUB_WORKSPACE} -profile test,singularity --outdir ./results + if: "${{ github.base_ref == 'master' }}" + + - name: Run pipeline with test data (conda) + # TODO nf-core: You can customise CI pipeline run tests as required + run: | + nextflow run ${GITHUB_WORKSPACE} -profile test,conda --outdir ./results + if: "${{ github.base_ref == 'master' }}" diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 2d20d6442..713dc3e73 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -1,4 +1,4 @@ -name: Test successful pipeline download with 'nf-core download' +name: Test successful pipeline download with 'nf-core pipelines download' # Run the workflow when: # - dispatched manually @@ -8,7 +8,7 @@ on: workflow_dispatch: inputs: testbranch: - description: "The specific branch you wish to utilize for the test execution of nf-core download." + description: "The specific branch you wish to utilize for the test execution of nf-core pipelines download." required: true default: "dev" pull_request: @@ -39,9 +39,11 @@ jobs: with: python-version: "3.12" architecture: "x64" - - uses: eWaterCycle/setup-singularity@931d4e31109e875b13309ae1d07c70ca8fbc8537 # v7 + + - name: Setup Apptainer + uses: eWaterCycle/setup-apptainer@4bb22c52d4f63406c49e94c804632975787312b3 # v2.0.0 with: - singularity-version: 3.8.3 + apptainer-version: 1.3.4 - name: Install dependencies run: | @@ -54,33 +56,64 @@ jobs: echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} + - name: Make a cache directory for the container images + run: | + mkdir -p ./singularity_container_images + - name: Download the pipeline env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images run: | - nf-core download ${{ env.REPO_LOWERCASE }} \ + nf-core pipelines download ${{ env.REPO_LOWERCASE }} \ --revision ${{ env.REPO_BRANCH }} \ --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ --container-system 'singularity' \ - --container-library "quay.io" -l "docker.io" -l "ghcr.io" \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io" \ --container-cache-utilisation 'amend' \ - --download-configuration + --download-configuration 'yes' - name: Inspect download run: tree ./${{ env.REPOTITLE_LOWERCASE }} + - name: Count the downloaded number of container images + id: count_initial + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Initial container image count: $image_count" + echo "IMAGE_COUNT_INITIAL=$image_count" >> ${GITHUB_ENV} + - name: Run the downloaded pipeline (stub) id: stub_run_pipeline continue-on-error: true env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results - name: Run the downloaded pipeline (stub run not supported) id: run_pipeline if: ${{ job.steps.stub_run_pipeline.status == failure() }} env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -profile test,singularity --outdir ./results + + - name: Count the downloaded number of container images + id: count_afterwards + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Post-pipeline run container image count: $image_count" + echo "IMAGE_COUNT_AFTER=$image_count" >> ${GITHUB_ENV} + + - name: Compare container image counts + run: | + if [ "${{ env.IMAGE_COUNT_INITIAL }}" -ne "${{ env.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ env.IMAGE_COUNT_INITIAL }} + final_count=${{ env.IMAGE_COUNT_AFTER }} + difference=$((final_count - initial_count)) + echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" + tree ./singularity_container_images + exit 1 + else + echo "The pipeline can be downloaded successfully!" + fi diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 1fcafe880..b882838af 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -1,6 +1,6 @@ name: nf-core linting # This workflow is triggered on pushes and PRs to the repository. -# It runs the `nf-core lint` and markdown lint tests to ensure +# It runs the `nf-core pipelines lint` and markdown lint tests to ensure # that the code meets the nf-core guidelines. on: push: @@ -41,17 +41,32 @@ jobs: python-version: "3.12" architecture: "x64" + - name: read .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.0.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yaml + - name: Install dependencies run: | python -m pip install --upgrade pip - pip install nf-core + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Run nf-core pipelines lint + if: ${{ github.base_ref != 'master' }} + env: + GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} + run: nf-core -l lint_log.txt pipelines lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - - name: Run nf-core lint + - name: Run nf-core pipelines lint --release + if: ${{ github.base_ref == 'master' }} env: GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} - run: nf-core -l lint_log.txt lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md + run: nf-core -l lint_log.txt pipelines lint --release --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - name: Save PR number if: ${{ always() }} diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 40acc23f5..42e519bfa 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@09f2f74827fd3a8607589e5ad7f9398816f540fe # v3 + uses: dawidd6/action-download-artifact@bf251b5aa9c2f7eeb574a96ee720e24f801b7c11 # v6 with: workflow: linting.yml workflow_conclusion: completed diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index 03ecfcf72..c6ba35df4 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -12,7 +12,7 @@ jobs: - name: get topics and convert to hashtags id: get_topics run: | - echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" >> $GITHUB_OUTPUT + echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" | sed 's/-//g' >> $GITHUB_OUTPUT - uses: rzr/fediverse-action@master with: diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml new file mode 100644 index 000000000..9dea41f0d --- /dev/null +++ b/.github/workflows/template_version_comment.yml @@ -0,0 +1,43 @@ +name: nf-core template version comment +# This workflow is triggered on PRs to check if the pipeline template version matches the latest nf-core version. +# It posts a comment to the PR, even if it comes from a fork. + +on: pull_request_target + +jobs: + template_version: + runs-on: ubuntu-latest + steps: + - name: Check out pipeline code + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + + - name: Read template version from .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.0.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + + - name: Install nf-core + run: | + python -m pip install --upgrade pip + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Check nf-core outdated + id: nf_core_outdated + run: pip list --outdated | grep nf-core + + - name: Post nf-core template version comment + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 + if: | + ${{ steps.nf_core_outdated.outputs.stdout }} =~ 'nf-core' + with: + repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} + allow-repeats: false + message: | + ## :warning: Newer version of the nf-core template is available. + + Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + Please update your pipeline to the latest version. + + For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + # diff --git a/.gitpod.yml b/.gitpod.yml index 105a1821a..461186376 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -4,17 +4,14 @@ tasks: command: | pre-commit install --install-hooks nextflow self-update - - name: unset JAVA_TOOL_OPTIONS - command: | - unset JAVA_TOOL_OPTIONS vscode: extensions: # based on nf-core.nf-core-extensionpack - - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code + #- esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - # - nextflow.nextflow # Nextflow syntax highlighting + - nextflow.nextflow # Nextflow syntax highlighting - oderwat.indent-rainbow # Highlight indentation level - streetsidesoftware.code-spell-checker # Spelling checker for source code - charliermarsh.ruff # Code linter Ruff diff --git a/.nf-core.yml b/.nf-core.yml index e0b85a77f..0a56bace8 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -1,2 +1,19 @@ +bump_version: null +lint: + nextflow_config: + - config_defaults: + - params.contamination_estimation_angsd_hapmap +nf_core_version: 3.0.0 +org_path: null repository_type: pipeline -nf_core_version: "2.14.1" +template: + author: The nf-core/eager community + description: A fully reproducible and state-of-the-art ancient DNA analysis pipeline + force: false + is_nfcore: true + name: eager + org: nf-core + outdir: . + skip_features: null + version: 3.0.0dev +update: null diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index 4dc0f1dcd..9e9f0e1c4 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -7,7 +7,7 @@ repos: - prettier@3.2.5 - repo: https://github.com/editorconfig-checker/editorconfig-checker.python - rev: "2.7.3" + rev: "3.0.3" hooks: - id: editorconfig-checker alias: ec diff --git a/.prettierignore b/.prettierignore index 437d763d0..610e50692 100644 --- a/.prettierignore +++ b/.prettierignore @@ -1,3 +1,4 @@ + email_template.html adaptivecard.json slackreport.json diff --git a/CITATIONS.md b/CITATIONS.md index 41dfea017..503be6627 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,11 +12,11 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) - > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) - > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. +> Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. ## Software packaging/containerisation tools diff --git a/README.md b/README.md index f45304ec7..e06c6c5c7 100644 --- a/README.md +++ b/README.md @@ -9,7 +9,7 @@ [![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) -[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) @@ -67,8 +67,7 @@ nextflow run nf-core/eager \ ``` > [!WARNING] -> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; -> see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files). For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/eager/usage) and the [parameter documentation](https://nf-co.re/eager/parameters). diff --git a/assets/schema_input.json b/assets/schema_input.json index dd4fe3e11..2ec5f1825 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -1,5 +1,5 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/eager/master/assets/schema_input.json", "title": "nf-core/eager pipeline - params.input schema", "description": "Schema for the file provided with params.input", diff --git a/conf/base.config b/conf/base.config index 1cc879ebe..870eb47ce 100644 --- a/conf/base.config +++ b/conf/base.config @@ -11,9 +11,9 @@ process { // TODO nf-core: Check the defaults for all processes - cpus = { check_max( 1 * task.attempt, 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 * task.attempt } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } maxRetries = 1 @@ -27,30 +27,30 @@ process { // TODO nf-core: Customise requirements for specific processes. // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors withLabel:process_single { - cpus = { check_max( 1 , 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_low { - cpus = { check_max( 2 * task.attempt, 'cpus' ) } - memory = { check_max( 12.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 2 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_medium { - cpus = { check_max( 6 * task.attempt, 'cpus' ) } - memory = { check_max( 36.GB * task.attempt, 'memory' ) } - time = { check_max( 8.h * task.attempt, 'time' ) } + cpus = { 6 * task.attempt } + memory = { 36.GB * task.attempt } + time = { 8.h * task.attempt } } withLabel:process_high { - cpus = { check_max( 12 * task.attempt, 'cpus' ) } - memory = { check_max( 72.GB * task.attempt, 'memory' ) } - time = { check_max( 16.h * task.attempt, 'time' ) } + cpus = { 12 * task.attempt } + memory = { 72.GB * task.attempt } + time = { 16.h * task.attempt } } withLabel:process_long { - time = { check_max( 20.h * task.attempt, 'time' ) } + time = { 20.h * task.attempt } } withLabel:process_high_memory { - memory = { check_max( 200.GB * task.attempt, 'memory' ) } + memory = { 200.GB * task.attempt } } withLabel:error_ignore { errorStrategy = 'ignore' diff --git a/conf/igenomes_ignored.config b/conf/igenomes_ignored.config new file mode 100644 index 000000000..b4034d824 --- /dev/null +++ b/conf/igenomes_ignored.config @@ -0,0 +1,9 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Empty genomes dictionary to use when igenomes is ignored. +---------------------------------------------------------------------------------------- +*/ + +params.genomes = [:] diff --git a/conf/modules.config b/conf/modules.config index d203d2b6e..d266a387f 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -21,7 +21,6 @@ process { withName: FASTQC { ext.args = '--quiet' } - withName: 'MULTIQC' { ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ diff --git a/conf/test.config b/conf/test.config index 1076ac24d..8a29118ef 100644 --- a/conf/test.config +++ b/conf/test.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets // TODO nf-core: Give any required params for the test so that command line flags are not needed diff --git a/docs/images/mqc_fastqc_adapter.png b/docs/images/mqc_fastqc_adapter.png deleted file mode 100755 index 361d0e47acfb424dea1f326590d1eb2f6dfa26b5..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 23458 zcmeFZ2UJtryD!S#x<#o93es(Ww4k)maRbte0-+a?-g^xY-3myTE`8G_KvA54)F1tn})nJ5u%TA4Y;^!^{48eL_}p#q-Umo0M|F1 z74+PQh^X8N|9_jcWbq~ zzn+tZC9B75nKdz=gQ8wo9GJ$P{D~3knlI_`-PRhCw34f1oYDLr^;oEbgxa#A^J%*2 z>FfDE*(~JzKFs$t_oeLz))qDU?s}%Q?7b~3Y;lUi^Oy-2@3g?joA4Wkgb6-2=ih*jub)~7yZ`T=L=Z`B`{1jhkB-iSjea94&Eo9A zxN59pv1p_}RO1>EC^q}Z2)ZI;b7JV_x4lMr=Bker2+EK;8~!;JO7re*@ZkDmoV878S*N^yX(F@U1yqt?Is3nnV>7}#(5pk`V3C) zWhB8;CwWIwsVIjH+`<9=YA(j&3DgQdFOOGU~*`36wNC&QDv8> zr?h2PQgnHkp&t^S)q^K!68h~`$PjZW&-Wns;Zlw$M2sc z1xR!u{m|Kih*|Hht#M@eOMM#8O*={^6b9k5B5^eBsrnhVHD7XZ5BWO&F?q(>Y=QFl z`f>yQ9NCoxZCH-1F{#mz_j{QeyY~4h*VeyYZ#S@Z(Pnb7G=ud!RW)5svqM*&GI_za zzn;8LkOTT?``1Ygt6w!2;5arK*o5k15cdIJnMg)IQhF_zVK%!ma$z&jL zZt>Q{!PqKl^`Qw?nJUOEm@@qX(y(TwSJ~dqW&M@7-N4Wk_wC4izx(xJMrmNjsl$XR zCyK&INt}7@FzNAbbg-nW)sJ>3->I1+2~YdlPsaS}^X-H0GR_CEsw`PGjpq`uX}8VP zJ)HC34>D(z{KR9;E&z=@?@q_|I{NPOj~g>w!$gR?Tlu~F+L$Mk%}xQEm+{&T(5zkH zacVy0k3w!T9r*p2sgX@V;^+PfUYUrEde07XSV=KSDbkIZU!j!Rk3MQV=h-!y@kWVB zdYkmu^fiU~pp#ixe4hBEMx7^LdHa z_L*14aVIHtrsR)SO?=&kQS&JR#^AVvln=P=bUXEIy$QB&!s34znCV@y(C%j9V=}SU zoYLHn+-Lalm0$-=QQ}a(+2dR*{DPF+)J4y!ukiA_T%dF zVKEk;c?LWheG#A5{A20}CKjMw5G%2}cT5@Oce=wqdobHC70=kY7}dxt3diH9(Zcwr zCabx8yObHQ@#e_wjl%wp8s_!Wvxe5f-Duin@obgt>qOcqN$$@{X^C_rEDh3fmM;|X z$zu4;D`{YRbaJ?o!KkazII&|th9v5MG2Mao$ytOHtW+wo;XJJdtLuGjg;d020qT++ zpD}e&o?SeKSqR`}4`OdkWNC7K)Wltn zbwBrWGM;bBGm8uP_RiqfwvDD1f+uRX>b=nTH9Y%vpg{ka0e*E>%<+3!G3#s*-1D>q zHg~1@BT52a*L>mVcP>6y*0iX8@!3tDFJLE+sRlnU(cl``hF`0Q>e4i6P8|wKmqIqI zoY+a0V*Bib0`F9nG#sR(8$^!IWLR)cE8@7XZTN%L-ucJ{9yijy)w5Pom%XG7V<^PX z$Z$U82w0qgcGmld-O6*e)?pm$g@!6`Pps5SPKccjDf(|vX9zcLs7t!7cyyckZI#R* z#lj(HqfVeqyZ+Va{)>65sAb3IQ%a{9W^_F!5!;w=XD}ZUHFH$8=Xjw+VE)s$q(nt> zE2^aDYki5`e73RQ=DxaBNZ6CK?XKCv@V}=y(g?YHnFaHfXnl}Lo;36@?471W;&#Se z>pE*@M{Y?CevLG8il9#HXG#W3>;o$1``EYBY5i<;JlBqj2M8Y2!+6bPj1(S_bOksY z<34UQE;=Z>KiL``pYd}5fpOOT)GJQnXfNiAc5wgJ>F|$Eqw&D*Vmz+#mM0oFD^`-^ zB~SXe{T+5hd$gnKd7Afo9cy&Lii@syPDFDK)^V{iWEAEO@?xzx1bd`ta z;$(vG+=i3~9|D=GX%f~<>eOVjy~-yRAhLf2dR8V<@M_`C^ev(yOTg{uf=L3uyDb-w z&)l7KXS_HTo87BxI}fXF{ge&5p&IHk9M1}eNAwqw)`eZSOPFhqjS70{hyE@C{oSN$ zam*`-UH3RF-RWEP`^Su1q#n_J{AncekkV4m7YITf%QHBo60h@pk4N4O}hhf%rxuIZGiQpprVMal%h7?8+cY#L>pYnx6v!EnuIgInW` z)w!NuTp;fz9md^}*x@K9+`^2LO*bZp1^?BG#iS@(4i%AB6YP023T8Eb?M5K7ElSpe z9-wA22Mm}VwDkmECLd*}a=7bCf(}@SHs6UBe)Xvk(+hQ^^unj5JBeo$=><{4PBI%P z4_9XQ=XnE``;1Daa6f`~rGwNj9{YXY)eIw3G90Ip+QEWg0%?g=i$UHuQ?Qc0OR0!w zv?BvlQa!QMyI*IP!0>goBt$xo2^hlD&wRp?$=}}#?q~Yw z{**_|5&yL*Epz|4V#SJjg-lNaIx_{sCL3R=_VH&_;oOn5J2P=h!0enu-i%FAZ- zw`Hm*u6N*}&A7pAqr>-?%0(lveb{r8>hpDmex?Yo*8!-%1?YV0R~VEPBFp>)ba=mv+2(#>WEy0yxHZX=Cr2 zKmew%=^>HsD3BtRR*#H!@!TTGcI&fHrVh)P&|X;>)OHML+uWDn(dlsDjXa;5uBM$r zdt!r~ig?5iGbx!GpH+kdG8k0%;~)Q#0L6wFROJ}^Z%DvO3x#yNk13^&ccd&l)BP9h zD5cU-qZg-rV3Sg&?)`x}cI3`zw#zq{-eN4pNf(+?QuOG4oZ7zMGSVqOUe>`u=GfKM z{xPCciJFw9%Pk+uDSoormR&c=fS#hGOk=RGUtizBOoY^8P(>!Si|I9i=1ZCQbcc)5 zgE6UED;+b$4u&#dhZjdXwO3tpG0QaQwXrLOx5YP#TOaS@FP!h|G!z!Pbv?hTp0eQL zoUsiv4d@*Ck#ID9-ua|zPbQepcC4a>>9-bJApd()Wg%}hj#%A4pO-q{jIJ$f-SL7- zo&=keG_jhq$Ty4e|J^l6j6TQ=W)|~&Ei6gRn<{*^cFG*tS19#kHpMD7Y;wb~!3_%X zS_-3NQoGiWCX!M-Id;Nsg7oSi4VJ=Hi{bYNfjnmTq?IyK@@&_uacfb&8h@DIe70-Q zZ^KaT(4UX*vf7@A7CY;P!IVGIuXPRIe^&71Z1EyHO5&^=jUUKHF+h&m!4!dOA+!Ed zfA#uQ&p6vD7|O8(?5`bf8^gK)6p`>+$c*yG?Sw29;OD+tp}kDD9augDAEXWbSVoie zpHF1Wj8lWfIZ}mx%(2XREqF9!{fNd&iurAaoQDMCSNo!vRHE8wH%QLLZf9u;ADqnxOaAD#VE%Yg z?Gb?EmGbY}a0|vSZPlF3z6;Kf669Bf%h zlSGiY-}E4LFurm_CJN)(*l?=uX);o&R&qLuzENz?9I%S&YQ2>rVhx#c!hbvWLL!CI zA8mXM$zjnnJ#Me@-99}hjxCE!w8|9w{SBlj%Miq#dvS5GHP!DxO$sDx^4PF^#`;A! zb=bZ1pyj{R#9h$r7svB$QlJqeF1cp*ubT12UZ!deKFG%1N<@S2x&2UtqsVz zn=gF&$D4i3x7&vdoa#^cS?bQuP69OpspVPxm*%@DSWf!NG`o`y^R~o1Hvta;#!r%i zvEB~Jsi~sJ7Y35P!bf?OQin->fAk+TpU$Ow1st|l9|i2rrOneBP3&aDyoUj3K{a7! zOYpnJyYD#nr4GNJ;@$ce2dSN=eS7f-VptzM(|Ek^ze)mPVrpAEgrFs3mL>f(ZwriH zCZ65HdO0|W@2<+v9t?J=-4U9>bvM@@Ew4uVZy@c^Ovw9`k|$!+CTAn(u#4kC7TVTB zXuy#d+GC@RIMaPyp|Y2jS%RJkktCracCaLqfs^i^XFqK#3z+d}n02*VDF&My)vp)lNzWx<< zGB7hEAH?7_joYR?>+&+JIas*%Oiux%kr*X*B=8N8Ulowx0MkRK?pR)K1F_m8>dSe54 z)48k>#|F!OV#yOs7xQNQ@1iun5pl;py{tx+o044?r{W2O{f}3r{#QS#4bf(|f9R3y#6*0YY) z5Ey{M`dj)yHl)B{sdmvti^b0IE5xFx%jJM&5w69;`PGy0vGk2ztSW|5H3~zhXO?mn z+4mo>;Y7=4&gC}HifyMO`#70u3H6;0|| z!l=0lP|zVF`bfxm{%i98943^7y4Iz};Z9F$oY3iUI*FIsYa=o=nS^d`;3?*wDxi&| z=?oqs6uDcd1e_e5z7M5q(+I^PilSRE(T6%z<=U8%sq63V!wELY9Rj%#Y@2Y+TEJ8(f_Kh0ih?l6E6~wDl3~?-5%7>d{ zKs0XHUeORoi5+U#M{kE!Ae%|)^dabh1DsJI9N~LVXp*8$XlOfc6J+Cc?}SM zsc3N~L7hzcpXn2>b(_YN=J*C0N}$f_NINTiV!~L}nA{wn^XfBogd5hu!G?*THg^mF zFJm@9m{X~X3t5{7 z#lWIO++R8;BTByGl7U;fz|JBB^*4R|bLvm18x;DF*U`=kyxbH2nD*RIH5AWfJ4^5o z&Nr;*|NreNKo$fUI5}~n#Xcbjr0T-7MV;wZXA(QPt^`x;=ZK)5^`AFgQM?7ry_(Tm z0|EhWs&cYJW?|uvc3af(tfuyDf$28~R=HOa#}3Edru##Wwm0a$Vnk=_8+eQ; zfyq+GVt0Twr^QS*HtI+&&>_<%-Gq-!{iQr-3LYn-6bqW0VW)>%iat!2IP)Jd+LgnS zgI+jJ-I9HMJ8Z*$2FjwK1T0RpF%U`&x)S{3HqRJ z5^;r?VoA(k7*aP@tzB`O5Y26jv#x54xNH;E`KzzLxC)FEnQ<}IR#w*>9sq|zFzZq< zdM1%ynXvcLfZ{Xm=l(Op?=XGV8`BwRiQ%@@A-GnjD+y3K zN2Pm011b!s`3368%P&MapW-PDulXKfpeyRXNjN`lKKgC%CplwE#GrRw#0FE#Q4>R+ z23B4CmO%uy8Y@;F$hCHU6+oJ}_cKgm|4Amr{$`38ue-?+GX1T!hd$w@x=z{w30Z*W za@$MLl^=f#*oR+8(&a&`E@Bj{{1O;DPjj$g9U7~{m*?^Tj}Rrc^wc=(SycXVT?bW{ zUus*6{74fo{nOh@zQyv0g{)t}Qekl*>KXQYCI9m2jqge|&Ntj{V?gLs*_GkeODYhf zW39Q1L1~vk+#E^S!nCyO&z9Wh}2=K}`9#{=`j&)^}8=U|lz}DqgAteVsos){s zDhK`>&pK%cVuhO7tPu7@Y4|yXAdHs!(uKDuLL@i$Okc6Gs;2456Br??ZNZiONAe!~ zvY5w1(C)E9fRmpWgWU2Su0u6~9{@wIm<-lha;uuEN>&C^FJ#^|oopkg``l#i0&{OX z%rI6Q>l^9J++K19D;HrFU#V9o0M`MBTT#-(q&A{|n-`T~CgAFET=$E_&pIQTPE;J#&nrwf2N^I*d zH)ev~7d=Sy8<@syK<`PFvNtyfa#8^JceG^ua^o%!fl6R&j--jGkz8wS`EgfEZouOD zr97H059Dj(#$*$-!UQLvb92wS40!wJc!4K~lq-K2h2rXunCs?SjQERnvv9Fs?tF;y zWUTcQ&PtDMbsUY6_&np`UGMS0ZZIhnDh~p{`Bryj7XS~*R}%z6 zUO^hJn$_-CW(;$)hHu0ej1BNqv^o%*D2gR6zUvCZyw)ddNB6JE$;okhf7PEEz|dRN z$sP&o`MU(L_I8mDW33;)3!U*;HRm$zVV%%zaDn^*Qj~RdWdFNb;^fRhnF&{oeY-tv zq$p~pZw)Ls$EWKsEZubtx_9bpdCfsjdy*<8_Io8VtCIC+8kk@Qxdti>xnu}nRYJ-y zp8$3YP7u;u+YlPQ2`o_>S?mpXvd0-x!Z3=}>ceWDg*e)+#wQLE)Uwhneo z;*y`VfoY<#lwT^k4BP(ytfI;M`FoYsedi}L{1V|Ho}ciBs=`@vtgnieHdpWz%Vyy$ zlnn?k0KJWOnlJD9>6y64*X=G{lyl&%pV8Uo&>tXw%1za!6*YYVB$jR$Y0XhB#1mVx zvjd8N4X~{Dd&28RVEkCw9TLN9*Ng!?9F88l2Bl)w%7!97mtx5(Qx%1u6h+$OGa4#qGGGI{Pj4d)5yg8F4O2sfu61u0uM}?$_nH8=0St?`ogZ@1LAr@*uC4Z9(|dIQ z?OH<_%?PD56K*Kty@PQT;W#)tazY~|I7-aq)tQ($$#Q?{gEbJwJK3mnk)|l>XgmJQ z_POHzee+4NEWu0i0zUFmLTF(zvD3B%sp1_F7 z<|O7{-oZ2>t9k~zX0MDQ(4&(YZ#~baV{$ah?o_K1p$Ad`PAvgtuhW(xO{@bMjNb>Y z-k>lsDx?xX;x5*9RSpJe~BwLtb79%{p~+JTs5HZ&#({u>j3kAOLx*Y zW{7^+`OD%vhcxVW39F$jZ;I@H`3X?>Wwt@269f1o{V4-t-|dX4x7L3j zUHltoa@jqToWvn&=0CF%6%D0h50m^)qaXkRMC&Owv8iG~$}1PBgld3nBE#Rg(5)8n zga7!2@yjoBBoF_e3M$ongy7N1L_hT@!LUaCXX6QLZFKcq1r;;Z$sca}zfwaCji7PcbfW7H9p`7Eh$-j*7-=%{5f&}TidFWiMr=NYvc}Q@gh_z)<;^d&F zd@za3ugvK(BbprUX|)`Rk0&+6)#sm5S8a7;dzrqn*f)iXpvW$BVu6u)bR+ywtGne@B61Om=Q)yvb`45S}|LKt&5@)wSOfk;LhZ^UofjlQz0h zm)>a9f&40n$;-ndr=xntY3nOFGmA5POfiIsfgTzT*Cl zU{P;It;qo}n}IeEA1&?GRONCJp3=_!ce2$kKRZonNV+tS_uFPWzeS zhqSPws(Jp?TsgNT7yGtphSz=h2-}y#HTWNE#@LHFs^pseT#RfN*P8yLUm`jG1N5s* zfU25qv2akmjD=Q`s4SJxi@i`xIOCdT5B%W6wj1Fz8)Kuv*iB`}b^(em~z zz4~VcUB9M5@W}s3-SOWXu+*?)Al7p)Bw?jh8_#s)>lYp{{b%_vCY00=iC@I3$FcpY zYuOjg948l-C~}cDxL!%j&X1(H6ZC7U5?oVLQ<)zh*qg)k6HdNPB;PQcbVRXucl7>@ zE`Ga=^8RPrIRE!3E#e-v8MTy%%a1yk_k{s|V-=5ML7(Mg#S@LA3;rEyjF&X1w*^R&VJ>2%B@{=W9BD)oa@0!_Gl{G8Oe+Vki1QQWd~<<~Et zEV_YlJ=t8VXv>#L|FKXIJ)GZ1(d6xUoSPZVFOzMhM$6tgyhWq=@}=HzWm&b4o8R}L zQd7<0PV(LqaHYNNcXtTN4rc2ov$)VeRm&}XS-vamGB^G4tspa#HrPa5#22^pb?s&W zS%!p!fba6R+WLMjkeUo!qpKob}#cMpU4(`C+U6R8i>qlJ&Hbh52enW<`FmyjlhwlfIlxyu$Pg z3uS-Qau7K~%A$hBFocIe2<$LBIbEI!uddh9(JX=++R9aM|DO2#5*qKh#Zq^~O40f6 z0#s@~v{DPy=4^A}ieKe(Idu22Ex4~>p=#u?w_Lx>bHE@Z4Dh%iKrDJj2IJ+qNDIxj&WPRXRSaNz$JyFkpFK#gLAB6G;4KKql{+5w z{2yWKln-fjDCc()q_W&mmIx?JvpXPb{)hR&ok40*!M7lC!&?b|=efwVb@r0;FeD2( z*x!h~5OA8DEVr>6PS6o_oYt+7HY+d${lh@ruB?hP=`vq;@uLNGIb%@~*X54+`NY0- z35nZLFQArwtL~;t?sb(T6k;wi@v0FFLV}%b1@;p|R%u%8ROV= zRWO3*fG33>>}We#nQ5Vk3gY2ODY5fL+-E@ zvWG%=(;1n3UEEjqSDn9V_C*FMSXjR{uYKa`>$>D#@FacqRX4qmy{)y4&Gf)@V_BVr zvNEa@r<%e5HW?jhEb!SY6v|~N%22Y0992I>~ud8In`Lf`QStH3E)x@G=`2&AraN&V){PF%a=v)Pu{I zuQ7a;TZAlAgDiVUO+`B+z-8%M0kCiylcazP7I(w|^h*D4Sn6R#-jd7ZMN@iJo=6v2GyL zo;~Df{e7CCta*U4B1pD0lfi=EwI3CTf2}#(`mwSD-u-%XLU(&V?BTG?P-Fx}R5*E5 zcvSdpxqh`s3e`yRJ6%Efp|NYd2}SjJ)h@$9391YRLSU!qq4E=W9yx#}_KqRcG)(~r z!+&i&OckDJQ2El}fI8mdeCHPcJ2=byp-dT&ZFDzLuqc{lvh)^vKB2 zL}g}~j~QUN0Fo{!0BTTKwrDjx#j6KVb>MsCz=!G& z0?uz!q)+3>Q|KAM0zy>+^zjMt4}XE)t2HIfc*Tmi?$;KdI7B#Aw9_O-Zg>98L}4}% zna0Es9syWr5+f5RGVqawtNUt}*r|Zy#6ay+mEGaSGMmMOW%88u6mXzDD_wlGT6!zy zpLOrO442P{0J&IYJjqwrVrEF87ZDTT<9iz5xv)C#pUTTj+d73+z7GI`Ehx*q&zxS(F>^b?4*udLeSbU~XBKKi_PI+| z`R!s3tpv7gX^R3~Cce0vX(P9@UCS)XwG6mNX_eM`6X(`UW>OMp*nTlrcUU?`gCzDr zKR0P?yj9z#ME0=e!>GupM|%&t{Qcx)sN)wVzW*5E>yxt5g6NEc!GR+F(!Nysd6n&^ zN?K|Q@t>y$%H^ z1}}eMB%-GY`CK5%Pj}AkUNRem1zBUE6y}0KA;6;dZu&VyB`KCwPfdQ5Xri>Osl*$@qxi zNUlL!r3OOxC4C`xXPqL4Ec)b`ajpfaw12E4xMZ6=Yyb-WN0LL2RUzLj zAKS$6X%>ekm|3yQ$#-`3N8ah|B+0f4bxDc4nfJcHZ{dlBeXYRL5bY2afSAF|vcc%G!HPxGS8==1)_U|T zNvWWGt}f~OGmCtqW8>q3f@5Go0Rce)p>g@dgop$3UUF3))$Wn6gRX7M3GQ}?tC)i6 z5#2fg?U#)GsvTF-;w zY-Nw9hPGMC9F9(W5F-PUEmiuS(F06nlcE{I)}b=%A7_~A6cEH$BClS~DB|X6Z*IT2 zIpOX|#S?qiLR2Osk#^=DtNG&ym+&FR*Kv8P<@ep!ZLZtJSjcEO2t@V!3dE-*!yhNO z<`xWq;JT2z{)iLD9MQ;&^p<*B%Gv z9;zH_>TGtlGO@9MT_xDkFS4=QaZA)){{?|_B)8Hw-q)H3IPzKPiHM2|2?0GNX^+EI zRf5>q`4yE?GgaPuK8|(quyuVfv-aF(wlXs_w}4}Na=7tnIA2P*pcwxEhcBp%Q-6rI3Rc0j@jnbz>h=|(@M6C7U>fx%lJG+#q2Q4af?@H7>c`6Fw&JpwfW1WFvJ!J#H z%4DH$Nww@r6h6K-1K$M;1QOi8g)GMGRywKGssy2=E7s%k;ESt|W)#O-pRtb)vf8-D zxR2gI3De!E>)xMZTl>m(C!Tx|_c}u7mC!FmY~hT4&*t)mO76L0VQ$Zm)=+l7>+9FH zfQZjFC%h{enbPhuNz~lx(beZsjm#JG@8B$iw_cTSX-?0fRc}lkFJafCcF=wqJsUd8 zMn~$&N!wK2xp3mXuom2=TlzBdg~W^u`*x0IxUuITUpwpCCpIqO47DsRfB}i?8mn+k zO?VOK*oa)bFN6F7oN04eyGiZR6q#;01`nk`g-ro<5USFo8#dEMz{N z)FLtwpl>inBl;{0syyqD<@D`l$#Jfl)EJHXIv_2TJFdCbB1tJq2^~2}iq9XvxA^o{ zn0YLREmF;vJ(gM2^u>gGlpZOM>hd=@e@%v3L4CC$gdajz11>;t>9B37u4gN+c2EaN z7N{PzCO`Ov_B8QVS#5&Tgk_TYRF@xdXvUjab#=&lP?prpL~g4|3*W;OC@JF8+0RZoP6YS5=9t%X5j<@=9s zJZx5j1kEdx-027b#7vEm4TRT9soiaOv=y$Y#MT=^nhP%|fDdU^7Ez#Ft2I{)2fQ7` zW7SkW?%wkBWnL)w_~|{}hkUWMk@uEt@uS1%?(3-dK@CnX)?b$25^pIgnsh^HS!eiB z?gK|C)llrf;ga;b^r9EOF`p3yYRe*y*MIBz1Bd-qR8TlBdJn2ur@`?phF`DfaY8;D zCwmvCvRQoWVlI$tetKk}o?MNTX9H3!Y@C`PXWV>S%$VZ{%|p4jHr#UH_Ryyow;{{;KtygLxrG7(#ca)wTYK z-Y0sN6h;=V$f!GPone8y(zPnL+1N>PyLSs(y=`1y*FQ1lR8e`3s=cW#m$+c=3)Tb3 zN7!8_R~a%Ek8tTvTN6~|O}BoxmiKrt8Mkh0)vSD{hV=%yVvnL*%!|m2!23pSnTfsT zwQ-^GnI8{pLlWXKtGU!5h-Pk2LFIGB{oj=);~!Nlji{=PmP~Mqtb8I%bKzXfV~y`v zhZpp~H7qb%5D%?Sa5$&Vmvl)54qk6v;W{B~UlL4_ z81zf;L5bb3SJPuc^~%Ua_>tB)$VLK>FZvy&b%*eB+g)qdbU(k_R*eJS(gX< zJxL0apH$ji6sKDr)n`3{aNlN^Qwkhtd8DRdnV96&?L&8b5Co{7; zvmmb;3CdwVs8W1GMY~|zn1^&RO1t0hBt(ULtGJTf^IAMxRpD7HU;6{ij?XXdjHv`a zw9!c(a5cYpR_vk~eKYL+k6gM+5023LHvMEY_p}y=4k&Q!!C<*zC^2Ia3C3Ji zL1sbM+*p_j602gKXP|mF$s?~%_vnUv zj52~Vd_MWnLq+!(*+*-Lw~%K)_w>^_onjFhcBsl-1z4eAVzf$ZoD9yB+;Sysedi;%NXg8B1{e-#F_eG|zvUc4YC2OlIpARjmdsP@u05 zr*U3jsq00uHQh{r5KWSeeT?KjD!)FjzCJInzFM??L^jL9NcW`?Lr-^4X;Bzlu&Q?y z02M)ULBT=3$s#1Y9wAzg8-+0n||g$cI`eH$?LAzF9rpS6h3c^3UB*o~o`&^2bx~YDhrzULrno%G+^r zq3*RFmK+#R^m@8?svWLq){v0z;Az zxet5`c$dkiO>9f|6fbU>MAIx-Kjc(r4SckyK$1&9Ug3)mVCA8Y1>GV0bcjayWKU?1 z;d6`Ui1G&YLMmdtb&4SB(ffffFqD_1Okq%F3-y=7Xr$+V_G^RS{QgC zXKOBBq9L5K2Qnz3y##l~^f-q^dVo0JTO6ysmtjFF?tQ4=Mh9FhB)1vUcK2(Quo8ja4+LSJ)Y<8ba zuA}O{%Nltg%FD9=r+$Zri;I)XEgq8j;?A9Ap0;b5j5DIM+@eRt2of>UaXBan>ZY7* zVXIJgT25e+vU`n3vm9;wD-XX>S5Izts;k7?q0ifUbXFZ ztu890yFSO?daUUr!gp4FD4cm`X`a_ImZ)oY+O^`2sgS=Z-sfHvxbI807yFk_pf??D z)@elHpxFmUW>0G7ey-bx)DpdGO}*NS(z-#}PYqNxLg1@YN}fvhUtBLqKc+GUT;OW% zO_B<`R#rcqET`udx*1pLFro0I)_p#G&G^C(J)_;ph87-;WP@^*-yrWnJiD`bUJP4q znYR1%sd_A6GDQ|qpc%2A)KEGs;Y;857S{2jmRaCehP?GUgH%@%HTz-B?uYLBrVgP} zH@h;%V${F6+&AJkBG1T_xqmSr-oU0c++uF-EFD zir8XIv!Ke#t=O)W|8PyRa?ZUc=)2$4uI5;dauysN?Iuy7nk&-rwtj_ zbqWwtQli>QcMkpbLD<<#ef^2AtKAu7XV^+t%ng>C+4%Wb9$F58#E^h`#n9f!Ps zj#E`k*Ev&FK`3R|?l*-YBQmL)w`1e~thLbiWK69X#vg3g_b_#aGcF(hyvqEk72SD; zu~^e}9oE2m94b1C2NhicobMMlg}U1!FA|mJle8de9Xe&=-H(MvA(68kA0+z|@_;-# z&(b*W+h^U$FizY_L_j1L?db`Rywq|kJ8nKA;QjfTaq4P?Nw-t8PTt*s02E}f>sbOX zogFNsq@})oI`S|>iHp=g?5*Ri>{ zfB@dk5v}dqihux<=+%{)tOw&-*p;K#;k0?3?5LDv#-^~Bshk-i29xz)oSMVH0{UfE_@k=$Td6mLADmA5HCS>H;8Elg7$zuRGQ_PzI@ zO7f{m&I)ngat~(Q!A^05yQ_P6@m+rB1*YFo4Y=~o+^59v4+%;&=jKhGbUydp4sH`1 zy;I`gK$wj(W`yp3Yj2)F9^2eqVW8uZJUv^BWHR7|G0X^Vuta6p*nh6WK_UPW?g|4H zCB73}#_XrDiYLG?L;{a;A`xflU$&e61X|e>FFS;FXT~~Nej^;8D;T+(JOGZ)-YCl! zDic2c`~DhIAgQ(OXEkNRICxKJ<<&$(86$}P>l1x?yCEt=imFk`Pe$TW&4$L37fnx4(%*=smL>0uH114m_}1+sdfuU!A0Zqzr@~p)h_Rae)3fnObHlP6C?me#TrO zCzi%;E6iC);zLiV*o22GEXIF{NL2tM-wS{K&aCtKGNF+iOQ+JaXYw|H4%FRB?7R&T z1KbAY2p!11zb8icU0Q6TPkZCL#ztpG;uZYw`xg!FyJfa%ZgI;OhQyI`fsLCle_S+t z4uqjjj%#Gy0#Ipt92R{W{euP*jXIOxh~qaUFM9L1FgE=XM~3_=Bba|6C*-;_c4HdFiehcxh0 z3i5W02=DV{(OsRR{NTp{O}%1D0O?=QOrHWG;?)^(Uyagt?*2oVuw0Pnoh8{=0EzL^H|PjFP(dF&|L7WETT0GcVgY_ zx1oq}^k1#{aimB=*)HzvnsDIHm*|-4-oMfmwO_ThrZR-9o)Q(i2K8OOn)fj<5|I>i zrMN-NYx$b70)BeTtJLb1l@(5>DzdL{44E$Db`c|6v{j8rk`njaT(d`!Q+zvdV+~uc zwOi(`abOznKOr4><!y3?&Pn`#_&3l#Gef?)=p3_f^Ui;vfzaAOR#H0C- zC_m1^677NRcZrEQlhb%^AG}2eIicl$V9+BoV;Y&B{w1=n5~3`>l3tCJ_iei91O5sJ zlfRNrKdWsWxAWWhrxQmbuci*ftO7n7Oc}WO%lj>uVaUiDKPF^(#js~|dl-WEB(b%;R&%wBZo4s*Feg>11~T!zk!KqRO#H>GQupBCvQnt=r+5tC~|_jcwZextGmQ=bxnE*pJAI!;`6FR9y=}o5@Ho683hnm=2#mq1!K9 z;~t#M?%xqQa&ju$A*O`A5Y;)3bM=^-yRtSfb`+m*&?NHD1^&k_^1V`zUUp zBQjO}+aSl}wx4UqTg2FEd)wQlHv^*CRVd!3FhGRo(ku4))jpO12ugP&rZjKiwWfRW zYw>!=HK|cBWxk2w*r^o8&xo`u5~q#7C$1%JvzI7GnjkBxN}y~)MsK5FzthqT)I+i9 zLQUJe#tLyOp$}IIr$A@HkBqga9H3%Ak12)kQ{#!2%+*+9#70XhbyV%2UkvY~D0|mM zOicCza3cpNf8-DDqMQ{MkW2mhk21pBOx#yO@k>+nz1ZeIc+LzQXaBES&Mc^@EREx+ zqiBmVE)B9tyJ8C(1%!qWVxu&JY>L`J5QAF>)IcL^2uZMMRMdci4TdEsixgYJCJ-=e z(Lp2&ix5o$VGm(RSON)Tn;Yzh>4%xBd6>6bx9&ano^!tXf8ROv|DAg`e-7-iRZ8cm z=ml-2W49d)ss}v#)i{V&<{UK+J~DWlkr^ixT(|EP4_lGEv+7l6mX7 z`rnoA>yKLGlLdp#ymRS3uTeX~bc`pDe>eR8u{uRKGM^xch?2hX5Bxxz6(kXw^chB# z#7h9KbJ}H`x6PI{mOk`b>sfNpaaH^>y|DfmqK}?)K;U6OD{UDN0WtzaUnVZ#(spqZ zVUr8UHtKKJjt*vN1d8xgpq!jad2C3(uDSb@6AQqAzw;SdN2f_9m=Y%6(PT^t2e zg=!ibR|V#v11NDo)>*m?5o>hTQnM~G5obZpgu!tGj(YQzF70x0uAV}pwc8nXX9bNO zbd)kXD!8@U4%A|o<87&s*`|`dnky@hr;;ZAo2~Bu2g7qn%3zfDbCVL7wu5 zo6Tn~<`BAK((ct9AG1D;F6BcA^^r>vEU%LrOxsOA%-~5M z#X&|sFPm7+R$g01eYw6pxAtP}a&bw{TPi%16;?Qf0?g2_F$#<3}XnXEmOcm0X z!{Mfdfq*I2fU-a1TZs929@5Rg{4M{z@?9Cko|M^ReIRLnw|jnGRaL}G1ibFOa|A7s z+co|6Dsuoxs)B@lW!!Fy@jnb5RF(!^gPXPin?1IG|04fYi3yRqp(DWls)4f1ZERc>4-}4==@QsXQg#VCX`Pjnxeb({{Mj4zJ&j-1gzqTJ&ZexJiN=qXShYkaMiouM$* zihdgSA>BBh>UG8sz{fP)%#B>6)ZZ=Zve3ylD#}%J_s_FUjp|p?zS5nme$D^s9D%?1 zd2a%1f&hF>jr5)w_Qg&=>>L|+n_ZGJ{}HuB-aWy6I|{a6W`Hnb;cfm6{HJ~AA5ZV+ zO^P4X_D8eT5KMzCi0L0n3XE^`Xqp2~J~>=whP^9u!!3KaNy^5JOLz)Qwu7R8tf2ks zjisRN+T82EvVNsTX1X}xJ+r&E1Ana8Qpn2QD&fVB#c4QXwtxn8H8-fA^k_PfU1K3X z>IqazcZf<=_}R)j8P@aQ7;I*x%o;+#m133p4|1XdRsx)DWgq8qRCq~o16CxrvV~U` z$2#Ub_snsmq87&UH8fBu1S$k8W-@S#nO1mvLoQ#oa#qzo1j5WsbiT7n#x9E6xctup zJJ%*Op$=MhR$JZqbv_dwGf|=jmqw4H=Qe2mw@dI%LXLx+E_G`7=_yvYv(qNF3xrZR3f^9WzweTrZ7WqEQ>&+*-xiy?FBw3-ZWJN4Th}bQmbtp<+ZqlYjQPJ zzNJfa4MuhJC8X&CS?MdFHTA9?=isQw$nkr*(2+Po!G*E?U$K}~)F4_CUzSe8@O3kZ^Er5IyP;Rw( z35J!UL`-m9!A;qPy7nr*dZ@-uSCrN8P)B_V9{n(?zi#F`+gKxs#*j zIH*Icy{ipTSyFy2@?sB~?5qc-cE2IAHt=n!gOV&jwpC}hxH_Kx% ztE2W0xmBmGr@cJg0cyO-?r1X(kr9xzu3+5V>1YzBtuK6Ra+RToix@7>2?<#qlBORE zbPI%~d_ybB0wTJa@)1vVt^ENOxF^N8TUJ5l82Ua|j9w5GM!ns$6;8y2MsryfV`-qN zEznw|%v2>{C)I{qY-dkz`?}Fkw&fQ zBN#PretyOeaJs1{;WawCpt=$SI;XBPp7InnGa1cDG>a+B>Gj%*6DIE9rWl)H8{q`X zVd*sdD=SM1z|Vy6zDVL-OqDUa_)7$Y%8SwTNc$fK$`(EpOnd?|qD%^KF$$pzZLs>; zv5g|58uwUn(Y{xXl&jn#G4$KyOX%KD$tr1&*MWVUnx;mKg3#9O_l|8-Q|n3o{>>eu z!`5^oYumbF>)9rC1!*L0!jnc)RWy#I)ou2c_^7-jK29i+|GW6{gJ3&?o*?PGQU4@` z$7-B=gU6FGBh1l6I?5Y{G*rvYh!1zuM?w70^DH5@`^PXicUM2_WGwV*Cy$rqr&KUs z;}joZDc2XLy+|3^isfRqI4kTS5mliCSf3Z_X+6tS(ggtRztKx~?*aru3zmUEkLmby!sE-ZloZO_Y`t>6Y$Ly1P@lk?ycSK)R&6OFD*7$sq=57)m6D?#^$`jN9!w z$Ftw}yzlq@^{wmjQf8PnYd!0E?%(f@$3O)+@w>P1Z=s-|+?A9NQ9?mM?L$Gi>i)-7 z;FZH#{oBA_R~(hZpP`gM2$z8$uA4oTeTsro7IypWIV$k;%@-1yjwmP?PVhfhrcFuQ zP*C1rN{T#HanoBrM|UIK_dfItqc6S?i^K#wb=ab?`wf!gEn-xkev5WY+aryTcai40c^)|>K>E+ec<8oTH!6Jvz?Pot=)BPAz*Z5>N7QUnkVti;^*btsSu9JUB@m~FS*n@cgXc6=9G3|4JYC@2aKBbRSEYonlO za7Xp=p9IuQxwVwM&PZnCJ#%x~OjH`hZAy4prD3VfDMm6~t%mQtl1`0vY z*HSSM%jBKyrWm|{+j6?LEI}Y3GvqKEDtH)kdJrmQRpWguolR0j=(SSeI_c4Jel05F zE(*$y81yR2r!Hccg3dmurS^Q(HErm&J9Lcb19agHm=hjsYU3Xc8JP81a5~KKILPL7JFyC z^*y&LQk#x%OoY^&&%X9NV8Xxp!e{Yo1&Fv(yp%lKzl_l9%%8x6n5Y`}aGHU!@%d=C z%jwtMQ?X)wPTTQXsI6($fxrBiWKUnp@$!V6r|EpIV72dz`))g5bBFxBNjs7q0h_?| z+eB8$4^{il7xeGQr?`&Hv+-V>O$Tf^Z*KOwdfAV%mO|c1H&BWl2sj+taB>rPpM2Ks zBTjfYnw03!%t6XgR&N&9DCQ*5^#-(%(Jz$S5s>P!v_TB(teM{aHrGek#kJFI=zD-| zcF#h8!oH(eZMS`5FU^Vlw!V6P zQzEMlGS7gS9xjcGDfav+vr-4~BAJaDGUC(`T{j2v{X^#xw?pNF?_27&6{QB-d@81T z-jvQ!gz*74P}1rns(}HmjXUJydQr5B-n6IgyBo%&<#RShWtQss{dV*2*RaN!muBb} zZBwb|QQl@PVS=EU>8^+Z)QZ_ATzx_hx8TNFo3PrwHnftOgs4nG#~VdD!^6)nyJlbO z60GZ^q1Vss__}XBJROZK>0Z}AUiyRIlw@c7XzjF`2{syyG6|e@>Q88&&ncr@ zyL*nFhnc(7S6a{Y@q4H*1@~P-uU$@Y??fFAT^^bIgMnpt^lYt6P)Fa+jKb4p zZ?a(y9I-9h^0XbT>Ehd`CI8bVkHh_97f{nGrvBL(!@$zC_yMt0=!XydN3CR@_mZc# zzSR&{_SqO)=z+GUr^3#2Z|8}7`RJTNUqcfKh?g2YU$bK6U3AHNE#Iz@u-ounY9?{0 z-hv)})tBIH+I?|E1_`mA!fP^WBqy3Y4a;XR(;wR(FXiVP^nw}5Q*d-Ej6L8FeIGK` z%;B=&-IU%>;#5Q2qwWxVl-YB)%VX;np!}q(Hrr5%~#e840K*K^J zXcHTx3)+WF6rWzaCOLOne!#;jc)rSiKz3TfJ8HH{jDli7`g34i??`x8>?ZHGakeMr ztT#S{d9E&*&kEl+Jr9sDc9uJ{rKTST%iDCs3SLZK9zkHq@v^LBWkl&IM4ozkJwiOb zFJ@BFr3c!#LQ)h73OTLoo<_E(o`IQKgW`QBL8B`n1TD=mdM|4BpF!RqRe0{f z!}sj9;oIzeC<8$;nc#j@&rR`xcC?El2&4SX+3Fm*)tPOw4vf0Cqe0)YKCS5&Gt~@r zw0Ch`M8b9}Ac`y5Jh^pQ;}Om0p;gUQhyK-E=%sI<`?H{G4fJCE8Bg0~Yw`eyyzlZ$ z0{*b26E)cV%nm-^VM5cm%T8daTZY4zIv?Z-=4^S0c1e}bT|tl0Q2xF!2)*JqxoqPu zzwg1BW^PPsEACOnTf)3YM2VZz=W7+7O@!6*ZcbkFflHf{n<}Jb=R0k%wKvp8K{95! z$pt;c_|DCr`-q29D}0Jo1$0`sIRo}!YjT$oixKNbi+kz)J?`?l;~g>YNifUW=0DG- zYBrDfcnL$m0;t6Onbp&hY^G8DV;IwC;Q3l8RRB%qZ4@Cjcp0VdUOW2yl8X4`m3NTNM5AZhNpzK~ z&uW>?=+MOHR+1U}-QJq1&EjV(W>ck82ABBmrymA;NF&-Rd0H%aM(Q(##X91M6JK1h zncX~}GIHf%?%Gl(hQdac_|HqCK*lo7_1hODTyeKpJCZ``dDdph+Zf*EjY@iNgKfUEl!h{(dmX0U zNbz!;kR{sBr3x_OwFRwzHcMjq+Qd^|;_NSb_QkcJeIirtLHIsFi9?W?mw5}-ntn@w zp8ke;z?rkP`_|2xrp?dKrxG{l6MPoj=vB_NSmHOjeCA(FV=LXNeov;i7%CAVc28G9 z@mmb6hyFD8B|rL1Rd%Mk%g!+s02W^9s-9O+^623Mj%Ds*tiBicI(O9ew4&MLXpmsU z^r71~MeXK;ldWsM2Wu6V=byFJqzATP#3zt}Dvptv`red+?eANkC&_Tz^}X6lIz4QT z=4|gqkA#pk4_}<`Z8htj)rv+ko*pr928n7rCSsBi*6(HW;cM+m29P2} z!v`B^9BA)Z01N_^hi#`)S9UH|+jgs0bD&Dk5vERZb3*!ZH>T|x0ZVYP*VcijfX(_@ zUGo`;5LO${U%N>I@>!{7n%wXrt*M;e83%!iq%TYl2Q6T%O|_HmG6MnCTs1}_o}a12 zmX_+frrnPAIVWAZxGn5czTuRDpLn{lWgd>$xrCl&94NcW4WeSC4<8m=z>K0w~a56+P1wDksK7nRmdn4Ee zq=bJC5eDh$Rl;@wG!s7z9W8A>EKEHl7uX-2KHbtCX+rmz6ZCCyq+AJ}JL=rJ9XaG> zc0_4LFR^}Nqu(@GPlJ{U<%~RiBSj!!U+O(`X~9)oy?SiFzO8#ni7%Pq)>~AwwRPmE ze_7!j-)1dPzAo*;;{0NBCUkzAQ$uN$Dg)j2qs!sZXqAq8_glj4a-dQO+U3WY9(o@K zpZe4dRjqQ`o(k4zxSoPv&Q{9ykqo5Z$7Yp)1U;p{WA(VZs*`H@nl$cjcABq(>)V z4s?5N_!w`pHsiSp$B%E%>iSm8TTbt6;YQAcua^$WT|6m2^lZuSvvmlU-t|Yju5Ca5Cb>mVJixq34`PMiwUGtt}AZ4}nLGr6Kod{&6Y zL23K+JOusXTZFb&$KkZ^W+s%0(kz*mg_oJfTo7q5DSX1X@*xE5(7!Q*j*vk2PPuCYwgK zvyhqQUV+>`k?(d+J}#z)d*3Qfo3=a9DO}4r_BxH4XV_0)Gl?0IWpq%Yub)OOVcJzs z@5FQn_}c7jruw>Kr>!mumWzMqYjm9{gbh+4*yAQFA z`s72sHv3!!_uuPgnCw$EZFA~3wt-&mR~@(I9$pBYf-i)lQkcnfn=dui!fKp`f=qMf zGFt>Mv~3KG=W#P_DMC)VM_j%4>g6vMd$p@|Mu$n8G62@#JE88MO+eyvu>Dd0q4p}r z*_wDCKkHd0uK2x1i}li`xrDIGkxl>2S{v!n?{=e@WS*C+Df7D1Zgah99)mCAHRME+#PX!(3lN1tyq=wT z4A#BN&r~(!hl?8D-(8q?pbPBoHJJs7`@|k~muzS?`<%BY3SNMFYl-# zSpNE*;$dCwjgys>^i6)kf_KLvz&kOo>VZ$g4^g2h;ERF7FZdOpHo%Xx4-x>mh95zJ z|G&Qk*S3oEGcz-Fb#*srb?`S+5oBUZl{ ztFc@4{$KCIbmON+V<1@XIkP&EV_d%Z0;RhHk5Kd@szVHg4sn+t6ke?YtZ=e*eNt@7uFX{LH`VP z^yuQ?DeNfC5hYr{6eFhO_!#y4>pYskSNdV*DC%HvK6rS&(8|h66ttI=%Cy&vI|72Om90UCr7>1mT5s8(#7L*CZeotBrN>eyyZ1y+y3kbcz4m? z-vfEW9v<~|b#Ecyu9c+N*w~Yk;0f+g-I}NLF)?J~p&BI4_yh!^1j|KeVf%`?#l^Cf zv(LTd?p?oHTwI)S7k&r8o%W^hPxSYbLb=HYu?J!Y7IGNu8gRMHF{b0PPqda(o9krR zfCnMf6Qi!TJs-u~PfeG_a3P`Xb)Ooz&ok_V>L=2FGr426Yed6D4eK>rI!RThXoL4Z zf2^+%$BEOJta5P6g<@7tw5Ju^!y9>3s}{sORA`w4DiS%(2m&pAJtZrv1$}_V7~jip zOlV{Z8)9#aa}htS_B@PZG!k5PB|W?gp&jRqcTImZWJBXR1eZCp-`6w51l2PLP|JP? zM$46ErF!W+LZau+=Gv}Q_oJR`^%63KCl{3lVv+O3mipCrU+{*qhztYzH!4Ls@KlV9 zp08Tsu#;Of1_r<4-;nw|U0ANUrWLkt`PuyYD>oUUo_8iJG~f_f*>(A;6&+44G*3=T zbFcz(rmCcU8N}ho36_>(W3DtVOQVP$Bs#|Z* zzeLHps63DlHS0g@i0LH|%|vN`Za4Nohl=1@0dJZp$=57}*hGUn2NtW5n!(AZ*Vktm zgb#drNEu4r#HCy(|6t@_DQD^g*UbT-8!9iDXT%o1zFtNZxGX%fxzTzQd37vPC2Qk_ zLtZd{996+m**lZV_Ps!9M#nrmp<4kB0ZJL(mKp;pt304=i3{bIYumgICnbo}q3k%= zLnN_OI8Z6hEj$$h`9sW&(#zf|)4A$uDQX)jgtU_L@|SfKiabuqpk*}sBu(z^6IGS& zVGu<$C;=?*AyPZ`c)55`TYzyxjnXG3D*#(2~YjfQBB=%Uc-N3od4ttKbpexVfi(dnjDP% zP)qx|aoO*D;_YcU(mOdDB9Dz$&}67?NX@m<*)uSEN{rrkFB&Lw@4G-`4dPsWuNcfI zBg&^zY{;aN#>#Us4ou&w3Nr6q^XFxvA=R`H4b%#FA1tlnsitVzCpKBH6?-hTqo#US zQmfRH!n0Ebx<;b*87&`E?4wSGru(E;y7_a1h~btRvq^RYgfcZD<`*=R~q$@dq?Wh%Bt%nbs1AI*a|w7 zm4RUOm;mts1-ZOP?fOaDIt19VbY`!y%b%Z7U9MYY0PibYEos;ZqDp-qD5jY%RU%k0 zf0A~;2pBOERR`qNsA0f|6F7vJ;leEZz{33b5<`tt32|_%Q`uU$a6!E)&g$#u&Sqis zjAgY}3tMtkROU4yPgRMY6rtJ|V;SYC56ie}1|EoFyY{CaiW}OyGFQ=o36(tAJ@tw6 ztvs04Ll0~YH<)zWeFiq4Z4e~I?>kj@U+>ZbVPZ^wLel_o!6A8pQE#O`*m*xGm2yt|-dK zogz9zqRwH56>=3Xpz*o*i)8CNc^iH>-a=8&G;LookL4Cin=-g;U{(gya0yHQBN*#V z-+9Djl$3?2p?)jnMYMI&ZTFvgu1Ol6gztlRnVYgu4ydv7d6NiN4Eq)WX+7u-$D5hG zzejcxt`LNOA>B-m&f|^isE63nL>{UhSZ^hY8QNd z%9wY=@rL0}Gm4O^7DVQ;35b6}ESjs#M4n=;_g0~g;S$;%PlI=3#T5TN(1vIx?RG|& ze?9D=$d!>9Kz$#HT;vNmrq7>$K4ItKfesHZloYtZd!?*Cneqz4G95ori}yN13AMYs zw@=c+oYS`n+4=%iskM8R1uwzArwQi34YnZPTKkws->Nji~nkb z-JKxW#*N=)Wo1kCrt}!YlB73}wlQU8L+;+ai|AZCw&yw$6A}pUS40VjfesufM~jO% zJXCarj#^q;E2~VlFdf&a8)YhLd6BDOKe4HUJCHUYvD(XAw|k|Uvh3E)k+~7JUI;{P zbwQ};*;OQkIPt1B?M0N7QYl{P~Z32{(ltt)fva$`&O@I;js25et z^u|d}?fNZ&B|_gU27y1YynqVGMFqIb!0}1ymy(7o9!I`}yT|?LvRaAB@yV_=Xo%l4 zc?lGXp&^M;o&Jqo$9=ST3k1{%9j8m#E;|&?kFc>5r;=f58-FfQ9GaYLD5&n?feBtL zqZQx9J?999Xtt42MeV`4%QxS zvSxn6oF~cKdM|UzA~2LWuf6@t$S}R7#DE7TE~@8b%&SIqlZvq_;??0-{jI3mA9y}I z=r&f0BuGqvrgGJCXGuOdyt*1G`gG9nz;-B{QxrMhhcmV+MZ?;@M`Fm{VbG+f?v6~q zn|1Z3w}^WEF8(a3T?nOX;hQhz#`u9l?S!oJvOxp}ol}Vpn3zN12FD^2R@LN#~aAA#Z%DCzEEK4h?B5E47AWNEtgHd_*&qz=gnKjQADb(QFEGm z=k_MMV*S*9_G1JV*GIwaek=EA`_b5Fq8BLfUVB69jYkY&0#7~Ny2Beu93_J3W-B$N zeR`OMwW!P{pnPjYKU$V>TTNAmijMm<|E2)R3pki=YaH0gq}I-}1f1N+deP}gO##jI zr;x2Gsn8DMs(8O+7&a3z=t_b2I)M>89E!MRKTF4dtw7I%e^Y_L8MHScesK~fXOvdL z`=2Ozb0TD9L-K^B?@HSb5*`W#=Sp!`IlRVIIznnIDh(#t4B%IkuaXtBaMNNuZPnMb z>gxG@b3a8e0FAuo#Ut0rE=Zo?x_hqjEly%-I#sJMF)*P+#$m_aMjrpI_IxdZd-zaW zGc`q9xfmU*O%H4Pguzr9TjZp60LB_Y5@O>;=?#C+5|j%@{;B>rwE^`fWpT_*B#5rR za!?D|4jL=|Re#)ZjA4XA0c+?@7 zrL9%1YoxjaPml%ZLv8RuCq9{T0U2^&Cu3QoB*ty~svl6uS&zTQ^{lWSmUmzUI0I`G zH4RXH$_lev+b9b73#qHj$ZT~Py1gje3k&?oi$@zH`Hd-UTq2oFK&+{qbykpzK|3{Q zB@Ob#(f>ppxZ7+8%_td4ch)l=2>hNm9J8jV&3Mf@_XB6hV@W+xIl8U?E~wpsh}$8n zv9YnNOtCV;7EmmztE&-O1T#B3_8-@^w6zfs-W)|GpTh51otY_I=_rvyH~gVG`u0F< z5TcwEJhbSh5Q2VxE%X^!-=$wG7rrN50kSc`k*4*V2KYBG*~?`NETlx4Ygux6eYqg` zZ1q&@Lt=9A?dxj8(VB*NzL$mj&g>cX{XG!KjjJyc5`ulwSSp|J@`?jgA~CVBShvbj zwHQeqI61YowaxZJ5kEa|d_Fwf&pobc2|I(9Is;!59O8&^{H>A~UK5h8)H~E#bO(%7 z71>&06own{+sY2Et*uq+-D{;K2P(=U3|8D{W;Ie&CeR$DD&e}f)DI{*i;Jd6fydDB z%gKw8zgWun$ukL#+w$k;=Hx&pCRSJS z7UIDkZ9wVOYpidSA>oeuv^__akbqBsk1v9##B&{Cob2qJY(v2ud_Vyj931TJWdLfV z8mzLia%fcD09lwTb%t!V#iwvcqA9n5(vvA=yYON#_RlsZ534sy@DzM`j+{*Rz-0R1 zh@or!v&7~_A{)eyk$}!zc1e*j9Dh(HxYmnS2 zQ?TOqoZ+2SHlA=}foXlWR3%eEZScKDL5yHfaK5hOVmP#L{B%b`chJ+qwbBmc>buNx z5aoj#$vGD3UQxcaCugdTD8y0-6G)(9oV+V>Vq(T`rTEv1l(+=1Nbhl&{ZmF_ z%pZ4@l_tyRMfXl^JQIk1AraetCnEB?X9k#F@@By6NbZfeRO*SSr;(G6pvUn6js2L2 z^_XXkn#*wVj$e^_4L8NQJTu76fiJj8u*7?Eza&)LEAw_IN0vR2%Af*hI`-BQ|-sIu32GbNaWR!8W# z(^e18lCO$alRw7TJbpcCPsf`XR0T_xqnUK0FIFk$$ER@Y44ftz1ZBF6J;!ZUZFwp@ z(J1m+D_5$d%9X#Gt9MzRlGFW3fC!h!5R#C@(EP6}mRH|`b?R-&TlvSRtcdGQ%fJ$- z77Y{wt#4CZm_4n=d~o`o6fe-5t_%@MG$sGvHWgjoZV{Y1uvitC!9`TPX-tCpIJbYN{& zxKz6lvqs8lQ4!_EZDx-XA6ap^ml(rgL;Jc(kdfQOFf#U54)Wom=4)zbeDnzk4RvvL zt}CQXQC{QlHdUIAu^XhvpC!YsqTDz;d*x%k6LNSJt=G{In^tspzRzdJ*H;%VP!+W2 z3SeJ+!Oh4h(-99Pw6L?Yv$n>v$x2K~DJd?tv9iLnag&jiMZNlRWJC>t-JA2^D6_tl z^`)iz>x7ZZQtUYl3$H4(U%_jW---y-;b!>%f=Yd@j~%v=HN?g!>L|8INKQ_EDfE-U zTy#c|0Tm^`un@B_d}FCUlYxPux3?EboLXB&00%-D(@sMZC_hD`^MHm2@FpZ)DN>B0 zy*2O#ILvPW)}*Z`DP{MP+uZ{KUF%tE0P!Qnmil%U1D)yfryl#om;!>Ojprp}Sco^G z(E-hDa0FxNVqY$m#H3NzJGU&Q8A*;7-Z)~!Fdim}3@WwEVjj%=p?7=W%jBB1?xT+d z{%o|EfKjuaB;@TKqC%!dI<+=wU2O8B{yuk>OCIKQlH)+QFad+y&V_2*wkfE|b9Nh( zIsi!=7R}H_Z5O+^I7$Sv22GIho?vb+DH zJP6)BFnqZ)?mN;%hrh7QnpziCncZrC1I~ef=N9u9yERF!25LrxL^Gonyj(03v50h! zf6BQRZ>TD_7`|e=Dz)BfdMD`i@YBr|oxKkrXYyE=ImB6nu=Cc+7##W_O-*@^wcHgl zyh8zrqkyU-qNd>OTIX~KexxXJWvF19VwhyV5iVyloo5Y2`YfM!Xti09UN5ic1$l+Z3$%;>iTx!rb0 zULiG>g|rJ?byj@y33+{3zf&#nGG-MrT*_i!F-RHBhZoo~KrJ$1Fx)-ir~nwgo`;!Q z5#l#@-E`3!h0yS9#HP$_e=X8n7AOD zg^kMw-{3pMo77am+Wy6SH4i&4Ec+>N*E3`X)7JSQh2N(!li3Q8L7+hgnp615{MiP1 zHL#zx)Qz*UvlrqQ^*o>>=-xLOOMNQW@6ri!2U(>p{lEdJYE2fz89qVi=EyTW+zU zR>$w{Baxi7K>9eBVOu2xOPZchP5(Y%8FtSqTu}~p_zH-&_uevjA=h7;PW12BY}Z1$ z3l1wF?C*aG=tNwKU-@U53^uu#$-KwQWqZm**gXO*5mDp!s}S!hm`G^jC}${&26Y&A z_W>GtDdpRtXAuAEh<9nPTS#+Au|aKc?KJhK;k?*@>r38`E5!g7H=s_gf1!Je#&~j3 zOCF!FqT*+-^NAWr$pMFg?LXM~1wm%;ewq~j9)%^Y70p-%n;4^|>?G0#pRMzcn~ujW zgn#Z)O`Pjx?%}kjJez`mz-~P6W*y8iqwE>rd|!PjWMx%oPB!(A-t-S85)L|kufnUN zX#lTU-5mP2`&=??rI#I6tCMcAHTtXptNIP9#dBMiYR3B-s=|gJ0wLS8E^=v2O=1NP z3d3z(Y^z7g3)Cv%Yvm(PE@Xv(hl&6h7+6lKS1oko?0W^--mdWW6H)WHtH zqena(0y+4QqT_Fuhe=z5r={)Lm_;gy(N1O6c-`*q#sT~Rprp}TXfE>^1em^ z@ZuQlS6JF)dAM=;7+>@Ycc9k`C=mi=fXog2_$^WE;;~`&_aKY#(XAu|Xwm?$@w?cH zm$F1GZ3Rg^q{CAqG0?zXJQ-a)X?EYk{`1B2-dbgwZ|ro1btIzv72A5W9xd!w8ZM zfhDYjv{3U57gDQR|Ea2K<~(``s9Q9%^9nyc?F9UmQ?L?UiFu7iBVR^?jZDx%KL67) z7BHU5@JoZrG$|wlNb7nMMg2>m#c34GARf!YKrU1i{VaxHn*O}UZAR0W=nr38(wB(1 z9z1#d2jUWs$ZWu3@Fx5_!(%&UKzzGH^&0WmP&BUoS%X{e>AXL>LZ&&;mVVFSN6!+j z+xz9qt9>gcr^>>@Ze7*wB*PjD`@r&suA0Xok`clMS`CBPy?sne0hH){>kQiOs&4f*+X>FIii<^3Tg z#n#p~9Z?~(v$LC0AmEHIJh1vzj(6FQXOlz(xYptM9uhOZlAr6?`IlCEr28dcIP-LL zoSmITkcp2JX)3FC4AO#tvaFS=pO~14^dtfUZ?3jzDl13*(1|Fu_5WB-Dk_5fNgm*C z`OhSc{f(t^W=9XmC2W3~+p1!B*M$&itpNT@caWw=xSsdwo4!6PyXIAEczzW)gt$p< zG?{G}UT)}b?j0+ROprydSpH=&Pbk$-)-&W@l`SRVWl~f9h%f1Ywq1+;vUp+sl}Ug3 zer@=L6*88L-G$C)SZ5PNA?(>uDW4Sy55SRPauXINCgw z3`mG1^w{^1$_CZqYQ!y-QC!7s^u07KtHO_Ei$S)$ewJTkGKzjtNVH8{`|HW!_|kkP zGM;kBZ61iOfcYBcKOr?s1!ka+X6?9Rk(~5Sqv2M!+~4;Gu{09!42cvM_mIiWdJcom z^cPng;}I7u6i;_qnXMhIWiJY9TUmIpU}L0IDZhR*C`J-)7GBRhR(n-;yWs<=YA9eS6R?za z39lg~N7|b|+lL44!Q4Zf23!wi^!6@35dUJ5KDGfvxPvQn-9+Qa$$UOZ#5&pMy%sR@ z8vz_o@Q_MbaT~7`ag78RA%Z6-KI*9J zdk=3+U5c^=8UKe`GftW@f}3YNvZ-rD7S&s_+VIdQ{P@+*{Efr;^Q9kE($d;@CPI1F z5IYiQE$A!2z6&iS@8G68detTm4m4N}qdG%oYo_(s1s>zaEd2276sQm@1fUc3>FG@+ zp%5_8aoDd6<@@{J04O?7hxl7(h_0&*ru08l*k70f*yrzxrEusY4Frs56ICC;4QHC^LBg3uSO9cY?v)Fk{Rve4!L zIh|cfrhD932NcF)3`VmyM#wcjS$_T%A)Qm*fi4piK zNG%{dRY^vB&qq}ox7X-PXfGaT_BTq3h=O@zLPlyHW;iPKEFtw9g}ec2Z85`x%CuH% zAf+M{GB!YYy{_!t_@<6wH;-;7o`+UkeG539QTjzk_nVy*Zsbx4S8xD?=TQpfRe~PE zzzl0wx`MrYQdS(rfCk4`-^4gk1*g47muU8QIs zbl)W83cI?bw!0NMAzS5@zP71;k+-;YFc(o4^rd`yu`to0Yl%Z%892f4{75|UZgeM- z5q9d+jMxBjilqc(mGD_)mbHpQTt!vk`pVRCte>R9+7=~oH*5(x10G5-+mv-`51ZFy zbqtu@sdJKLO%89%wpLSO4I5ag0Q}R0e34y(;YhJS9&su=B#NQ}&R$!FwfZ`c7~J>+ z*C=l^KhH35S!yU{J<6cwRfbaDeegE1vQB(?TXq_e%VT&k5}EpsyeT}Odqv(#e}WNSLsXX|#4qM^5(OCX zv0;GRx4ym}5)zUT;sp3DRaI3sHZ~b|!+=b)(4((VC@maT&XW1uch<%$h=_r=(pqJ+(64TIjLi_UZ7fNiR_W; z>c*i^oPpsDQ99}sQO8zVF_p3r;=PjUJVH&c3 ztXlM}{=d>lkVy9ckz)RtX2_IcL_DD1Bsczw{lOr8pb13v^D7sEmPg8^B zu+-4tv2m-LI*y{CzP@3S%2lo5;T=xI+Dl7%fwUo){=}==4{E7Lha~3I@Lc`PV7F6lk0Dch*+& zLTjd`-XfCK71T6fA~P5v@ zwe}q)3=_{C|8D*ox=44fnHIz_`t7I(Sp-j)TCQfe%Z!yhoXf$Q%pzBcNqXOcDoVBZ zfwVX(j`Lb)cauBf8`Bb^^`I;m6}hMsrq|pbUbAeC-^kXGO!RcfD>FW6O^Vr6Pt_TL8bS*QSUbok1spKPn97(M zu`f@B3AS`5iDa>)>{qi0zbb3KCl1a-u z`W2{TSOklXmq1zlJ*FNo0<}+Bu?=G|CXauD>a#7X=oMW%Zydm|;bIMpEH~lg<}$N~ zIJ(K+@b=Y-l<94J8hRU#0@*Nj$^H`^eGf!YB@#WOiD%|*6!CvCV*YN4{NI2+9Ygpk zN;3?vR$(2$Awhbdm7+>PzrT=s?3)zTiIzJB*IeiB ze1%82N*XPlz0-g!_pAL{cG-%Gia`(VpRwo~fz)EnikyxsA zfiE#JTHH&z>;n%vj+nw=>s)sb6B8cTz^?fCsPSavW@_r_w9n}Hd*nVRKZj>XX=$o? zdU-dqs79Rn7f@8F$#$x9)|Nv}&=YjgE21}yIuB(p{Exzf_k;k z@|I*~`Sei{ovr|#!+zqSYAj%HWj*tCCQW4eSsW5ep2sepN89 zc8}AB`%lfQ>t%j^X0sQ<67;*}&_UEJ4pquW@K$8wp&|Jbn*XwjvQ=u@fIxMX0T3=Q zwgAG>8k3rv$Y^%RdudRn_r#PgB7eXW92q%j?*f^<(;uE?pfNQb#plPIS8(n7muwf~ zendM75555+qcUQ{i%>S8aiV5Ao~g=A;qWiY>Jd6ftV?&k*J}Tg-z_rq7?7zdg^Pk+ zs4(vfN~u_vXv};##Y{{TPQbEf`p5`25(ffo3M)7n1#I31$r=c3RmmQZ(SDyk{o$d~ zE zP~2h+p&5sT(E2>ry&!a>$>>*!(IN$rQTDZIeyxP8SZysRVW(Iab} zWu98km0)kVV2Txmyb1|rpl!vdTJ6TaW?3RtxicccWo~{gB^Z<$cqWVpfnW2W4emEW z(B;&;w(r1>5|^BgND2qcJs(%`AK?5+{+~Nfr3Gu&@nM(!4KL|W@AScWH;PI)@5WK1#JpZVwXm|XGO!w}s#Fnb+wUDa8fC;f$y3QckY`UL7=2`i?%yvE*DGCSWCqz=|Hr_5R5yxxG)E9x0Ig zF$Bn#KVz|_g@8-;r+=3Y_;*1F--_39QAW0x7J&!rC7|lSY!(qx4WyW@^3$aId#e3^ z&!qdEevXj!H->BEj?Nkm4nP0|LzI8P*~sZpjIC3PoD$^vSO}o4%kD0Y1i9Eu#5=MZ zV)IevQmWUK0=Wh3^;4=N?9$uGQ8B~ZK-ge^-$@SGRnr_FA5~RV$f&1zxLPvtD7Nc9 zGF!k!r3epuwK(2oYGkETOXtzS;mY>re+*v>Lg3oD(3xN)1S9AOkl99p%J25PDANqv zF#oTZdhLsRBF$gh-vS)?|A2*}kdQZ_^cg^QY-L~zqk9xC5FtCoV9AUvd$GdupbAjr zDA(_=W=sLQ>Nx)->DIRQER58zWRQLa2o(rW9rPj>`f%3& z3~7zmB?z9(D{!SU^B^8Z8cVbeG^4{AJalq{RXl@w0yA6T83JsCqqnmQBdBeUAaoCUQCy4(yz%qwVj~CIj|`+;wBz z2&LRXuaWDz!XMKH>_r6j3MR-88QK@jYw->mfidcCdNhMF&oXcvC7f9aGJcqrGXH%5 z?mg6j9Ndh_;wwBu5{oV+fLMr57l?r<_+tf(I>rt0i2KQtV!wU+_DE@ee}72{qw8=Ge2VrekHh((m8dC;yac0QM;ZTR;%GrGWi}$&nE;n6Zho9I#i~$S4!x zsvvi=Sn<~Z0>Xd2Veda>?q*see=&DJx`Wr9pB@=X?VIVdRi=k?Mu;tYlmaLHVSEQ; zHKJs8$XykPsqkCU{!3@5NTCkjDuIOvrj~VmFNta49ZpFDwd1X*vJdLUDorE`Tb7#E z(h)gGsMd7BMSVAQ?Pzm-l?UC+EH05gMv)+g!?lv0-o}O4$$;)_zz#tJ6NJneO;#|k zcV|I|Vw5k9DheyOY33$9Mh_`_20)v=C3&+19$1cH^-^67btEHpCk9sJ-lXw_$W%O3XhRC$M_ZTzqZTW1rMQrh;#tCrYJsL`$&n$ zV4xJnZ7Q*9ES8HLx@R$8Wikv7DY?15J5Q3iSH+tqInTZtJxF(@Hj)Vf_SH$wzPQkY zM_dg*Fh*Yy2&9J(r@+O%%eHY z{fdsKWLh=Vfau|*|J=&_@HZh0A!rggMZJi1)D#fHxR<{&l99~e@sAxG$|s7wMSWi| z9tkE~EN9v75A&HX>u6%YcL(y_KQ@JhI03PIKF~5#=u9;Mdjb&2 zi+Mx%rZ4$^ZUMO@uKuwxgo8W0o;-TlSj@aXgMlE)8II+=K4)&q%8tUqjR+KA=I5W9 zoP34=2Vjq{H-B;zJPl~NXbfnLh%9|aPtW^(?vMCCT;2vigC~KJ7yJ+G-D9s~ zHhJvs>WP?|3OInj0&IYB>cw6c5LEa5nqr}8Wb>!asOlgcr%h2)cJ3`M$J}5NfeJ!4 z!v7|;#uMad=D5uRtAbso<_Ni)t^R&<7%=$2rJF&L^7A#@#+%ALHXB)iF0SDJly{zC zO{H7kcg9g%ac%cTYalgN&8m;+>7;sRAQzKcsL! z9pdSp-)^vD46y^}ZSo8jw7~|G+H&sxaLztL2KDbbZ0?mi)ClgWC9UwIH- z17CgkS`JW8#g)EVwxU^5+l4f*{DI-wYZ4s7KrOL2cH>;^Xnc(=#Kr}~2eBT{{rL|d z+T{I0lC7_u7L1*@nrq^;#*J{QMywSe;GdeohQ!z2&9Usb4zV2je%+=8FuN-Wo4osyaw zOG%I|3KuP~O(nBoAZKvJ6A99jOgB+t0cj4+Lo|*^>p>a>K0)hdeQ;2Wa;}St#?YC# zjqH^IvcbLR39D`;M=8&11eM|>vtMMy>F8U)yuzWf&YxuZ`#?v2-hm>X!;}?Q@tB8` z!fOmsT#}Re+TGXCMhEnH$C*(=;_j?TzK#I@Ha!F&iI-)cfvO?E8!?-H!PX~Qs5H>v`6bfxFdo14N~kp_>vNA47z9PSn7%X5y^mcq};(@5$Yu`t-EWoV}Nke?`&98vC<*d=66R>Ot`8# z&|CP-8zazRrzcgs{y+q9pK1zgX=wp%_ij|<3-f&wm;7*oWDp6(W09gQ^?%W3)zQ`@ zzb#zM(6}c2hLvGwM~6Y$Vc`5p7&xHw=!*Y~s(2_abuNrPxCD|&3ZLl?0n1h_W93W6 zFEtnb*4Fnm5r3wf;R3RsCNFa5`GaNrx3MNj=_*sq%2s7biEbNm29*0`N+J z?>wQ`W|IhmA&~T7V>k%FP@5# zIm6X<<~=8J)gLm7G<$|s_klLm>pVM&mt!%X>V{ z8OkVf2)fqC1ux?`7>>0(P8yDl9eONSW-J802x>U_D7SKUVN8OdWk4J=8-pFp!QLzd zQ%7n6R@!8d(e^m}AW)q8#|XNO65@Hx-2Y3)5!FR3g(cfI~Sf_55# z2s+Q)#^7fO;5k~N$-(_(>659=$+0#FiLsZUhdqwx`I<~ zHJ^Q!4_~#&g-4JXVg8$PBEVpu$lIAT^{I`@OmXtS5TUWE%kBwo!4fhe^S4{{(awhkNpg=`Jfxt7In5W3@)d7Pu!C9DL?p53ulWm`KA<$hwy zq|f8_?1?44Zy54Vm(HE2uSTB_I+peknNFArf~kp+JZ9*00w|{PTT3>oo<;tUdKP;E zy3bp;%Lhlg%MoWZ%*s8ohb!q*bw_O%fZ<+mo_x_QS2Ig97-(r{b~x1dX;w(Ahb3P@ zhB;Alm@+MXF1aLp@Qm?jd?)fPdg$v)W)C_WnY`pBO^y}|gCZsZQvLGB&i0}7jVtQ4 zJF#^&B;?E?-DxY9y?KP`1a+kHKbQ(h?p5%cI-ETT&0w^qwUaaj4qjZ2f1|$t&3}D0 z=~Qp!^=;k*bN=5r0H|vh{?%{)sc*Hc?H`6{zFYe$%gej})i-mCY?U-p=O-g_;x;c1 z`5Tfk0{;XE5c;eAZ%apj{E;*OJV&qN{r!zUqns`1R*`?yMtRU__9FUccfm@=5%t>o z?GxnE^u3F+rkLTd{Cg(8CbL<;l{g`}i)|vBn-57K zgG0xIe}6tAb`OVR+#5H$A-{lbmRKc1&N^fc4GkH!=M5*buiqLGE^I;Tj{?kcbTdyxjot~Y4)i{T@hjy<+1ZtZ6PrYMk#S__K>z!*sk7$GKuvkx z?Djz=T;wW-XPZA})EM)jR{O|pP}9628^AQ~KT|3*P(rZ--w8P$(%*a3&ZNbbSHVA= zSSGuu62hoS|SV#5o~d8Ie%3Kn`pAEv$wGmycK$6 ze2tBqH2Gep-~V1)3x<$uYp13^YwHA1TXQJD*?-6^4+O%+rmG?xOed7*-k1l0A%y=; zo+&mm`J)$+vXlK+AJ>@J-q3;xcxli~dtfOboSmlY92GpecZHh?CF9sl(lAfhRNWWM zS%{$~_s|hk3?4am*~o(9T@QU=P`KarDm_!i*_LDL%FD<{HfKPzgzMUSJ74=1`@zxV z$zvx=tug__=U0JRc+R9+5pkQ|S1`rD&hp@UF6ZZePd%IOY?4w>Go}>l*@NnwtOf?l zNfmKVC=2@BGUqJ4=s;c|>1}a3!>md^EtYnIogbdvoH@It#ZV)P(E0qw*=GJP)G$AF zNo#UDhNK1p>`?3tho8JH$#>;i7FThZyp{;Wn8=TSgW-^4?RQ#+;u0n4ORbwuGN?V& zW*`w|wo(VHzF8mtAtkMN&W-w^n(tU5k-g#!ov#Xj2@Cn>({ds{Y)Z@PWUO1W*0RWrMHS< znBh&n?wo%r=RcECC0y5m1D&HcJ|^j#>#_g;G++H4`2p&|1&=PJPlJSdw(L1z3E~^1 zeF2=%`h77B`~ZyTCXt=x*T*ByS<{=XHUM5n7UgQL)Z)5`>Yjm-b_L13+3FNOZ{DL` zN~Q*m$Ayp(+}AlOWUh8LBO~K{aslYufSv+iH+}-SC^;|1)(1xG0n+WW|Ji(Gz9$%e zKS#nT0^CdknSN%p)XG8T=afjZ8w<3PWlG=~KQOWyC_OpwKK>PIY5DNrYbq-WF88}D z=%5>{>1wlm&Gt2LAjGU0B^}<~|2DW|_Mct+|NU>}{s0=fkxOzeVt898QykPk8WzyC zN)(a`?^2$3WL45|84$tLP3Fx&)eG4o=bgqD%<~KP!{u4iFP#)~J`LgE7=y)&f*=9#d);a7Q8)-D$BoJ^VS zw)A8ajO299nwOo#LNTv>@nxfy+|-&&Y|Juq+c=H=RaWNdxL^ExT-==3J-$u%NR<0|q1J2|-=;+~ zZvV89e1rUh!wxsG3>03jkj!n}M;a9p+h!V#*OkUI-{2e1C3qKF))`H`pwXSmRZI8m zN!63M$~>)KK?NJ27VWY*W zQ)DezvXGXox+lf_XG3Y=;j-Q;AX9Fpc3lBjt^GyOe9CK!=1*F6+I%S)mnNLzBgdiW z5wRFv3J(0jCurDdnG4<#Se5veK#DPYDG#lEbGMmv-sbX81BaIQ6tv<-UF~T@P{n4x zdqIkQA zOodNJUK(13$SPhA9L3h7bd3rL{ z1}>QfUr6?f$HV>3vIIu>u_zfUYk3sixQ{=dyjyP)*-<>Rl-WpN;Dk@-#=pbd%1u;3 zI}77;buE^c4VC9g#%G%EG`Ky6xkT|SFxAOSJyz1}vVNK+j@;#k@1UGcsw;Np7(&b#e*M}=eAT-#<-voHLR(k94qFB!M`88NHLy&+9NzwOjvB}Dc^j3w*(SZ! z$>r%KIZ-I3PZ}Bm!Q#}d$##p4_|J~8xGT$(l(aiTeGJQ`=l@vfn_jb#F&cHx#281d zTV%aw&vzZvj?=#Pz9;X6=dy%dptg@S3bVx_!D5ioU43vZt5prXDPW-JTi^nY1 zduhn)cB})E7hrmc9eMY`%JodPjoov$CC*+P+7*}y&>@`DE7s{&`FQyYe25|qj*sh9 z`FJE?gKs#H-I-fS?fs&SLeXwLh5ls;$cD%L*3U**Whf>~YD1+`W=9V*;xM(IzwO*e z5MUNS69f8NQ{#1e#Q3Xh6%5qWu9#MPj#Ad)f=maFvUlyYhEMJz?Iq`e5U>r05PT={ zY;$ziZ&6YieT26!PTJ8DTg}E9DJf`ZDi)aZ|ImzJ-&8H8OCe&{N{F(&_|`l68AV9K z`~xF-A~F}$=&>=4Ma;DphRLhaC{9z&_a8s{jIhivFePR;dFWJ_8IM9Zz|%DwRQ82> zCe+sOMnYGIms+(lz9Zl|Sa;r}br;K=ZJ0JD-|iR3+2yX$xlGI`GTSN8mrKM~RL|3X zG_wFXTFzjlE>t6VXMfQK`6U;3x__y~qE~{gTXQ!hR#rM?njmwN_Z2jIP4C2BjheDf zalH&D&klP1KAXgJF~~+CJg&m&o}=_;*qPijdrEQ7hcGCywgBAV$TK6Sw>h7P=gNk% z#D$2sT8pYK`jcq*lw`tuvb?1HFJMKX*X<@bK2UUBR@ee3AC=bTM_FA2tCz0^D~h8n zsy7B*rI`Q5Y|MjxWxFU%rvEqlmp#5&#T3nOLuCGlU_i;MYLE!O`|@%;cLx>55t=*F z+@g(5+4YKAzx8%8V?-)@s_?{a?dL(3TLtE+C1+^cG50=E0P$`2?F%HXIh1-29v^_q zj9;xJ(r~x;A_M8}__gSs*rOSlQn#wL2)l6EuZJJqaCQs}m^$LnQyPn6@6YLprz!j< za9!FrVMslV2|VmfHJ*7mA}bAvQj!Ffw$~> z+aXTVb@q9_-aO<6ux|$DeWb~l;!U;xqWp%Qmg{M48sE^Bb!>@J1j0( znVzA#l=qu0x16mf!IOJL2%$BYL0u9h^BQ-RcTXNbY{Pokw}^jmrd{%i+D;ioXf6as zeF*`8h>S;x7i0qNZ0&Y*sA!Z2-$70HnrdRKelU?9)CqTQaP-o)kaPj?`n$1??|{_* zOkn+g^jmK&{duW1DX6-u<$$m5@lp(vzdVKw=p6S*o}D;aAgjr-;;Zedm*W?oavRyS zkxd4}w%V0#mO$C&k|hZk>BpO`iZ^Preg+8VGqsXjpc#<!dv!hWLF=PxZdsvP zxxdjp(oJ3Btv>~>HJNW8_X1;AW_8enh_2;GL)Qg_}dl$aoik?y6oCZzkgwBS*tGN zWq+e*&En@~`5T(W>VhE4hw~R=61r!`UueU#prxGCMG;es6dM89yOkjb&yJZH7VozX zVLHwAe~4XeGZPTi^}Wh17IOhOGCjMjKw)u&4C%B{QR?7qyNcjq6a!|;a;*%xrrnoE z1R+Y;N?E#XR^d2E!kOh_OiW#%WJ2jY=zV-3Pk?Y)SxRfFw#Qd8OgD#7X&simU$O}k ztavikwkFOkJb}D(UL+LR{l9Tfa<9Xskn%CEpK<|yb z%cMqs@~)iOIKvItCbOF!ze=7RLYtlAbcCqF6C_>QTRWvKC+4o)xaId{{bn_ZG!=^P zQXiZ4>vslir3*HSg}h)<98;`<#-iudnoVrEV}&l}KBd$H)By4W%;gCtY2xILTO{(G z9V!@4%}`SUgPL-~&e%&+$%f&=yG0(qIrl{3NbXKur)g?Kp-3=zf>Z9a=H_d(DS zW{09il11yfqvVbxD5jM)p55zRGO=cs@-E$WRZAkyq?Qj)jt)IJ23P}UGJhzH4yw0n zFTkb~RtJjie>}l_V9)#iXa|Ts%no$j^;Rcysx-s_n7VHaF)|0PPY_l2Cx4I&vp#G{p!F-iaeM|p}i^0f+VJ;eAR^MA{7~hUf+n)w> zh%sR>=|pTNdh`MV6sAw#d=>!&pErXCTY{uBricm=D+SU5939lkdQBS;liLVrnqB$~ zzKbZf-|0#iTIkJ|ml#9Ku;9lgs3Jh!{H34?MzMCMmKb@AaslO7un~1lx=N72_QfSF-e(t>6VS4+W?n1q(M(FE1yW)@S&9g@Z(#V-pv60ZT`MAxOH1}X9w(ma~ltK zkz#Rj)1Mh_edt51gJ#ui4Qe}LO7xfO^nbb8e|5bktt7}8veHbS7PmFrPDwMYzg#oD z{Lwx7k}B9bM2~mY!bil`bjC!SAJR1_Dk+ZHH)|V*jx}sXbcqXgjzbeuA6Y9<>z#z+ z7MqccdbWm3uQA?w{w!jxr?2)TC@k+@Q$y0t3O?O=FdV#OyJ8_AAnBj9XV8gf_yQd@ z%R_=3DvPA=X_y+F`_&ig=$vy}g}w=g!@oUhZ<;9NF6$rY)g8RbvX5A=)2Uuc{bJ)| z3R4)pNbC2EX-CC2v$4V$QHj`DHBOdY4wP0&XB&K^m@Lrevl@k5ZUhYnzRMnI_(uU_ z@tD_)%qc|;D#R?BLMOi&*m64}_$~f?P?)!mPk2_=r-6aW%F3{tgnpmdy~IoCj9N^lB3VLA*FFw0(l*lnVV+3&PuyJ2b3Y6J5D3U-^fXYjp#seSEaJ3C4sJw-vVrNw4Te&sQ3yZO^Uu;)9 zAkoki_0WebPq)Mm zw+dv!g$ix$!6Ns)bY*BcT7ZM_{lF+b{i`78Eb8@*2I$7x&9J_L``(FQCsZ~pt=&-8 zG3lSxqc|&->?wL5IhbRcDU0iflJtJaQj!lH%($2=@U{waSqxXb4(*mqoC)0Kv$IT_ zH42b{pfk^m2oIPrpCCrr%~aU;QZ;NEUyZo=Q;d*}OY7w|xnBguX2i_6SF^j4cVcUC zv0Jt5!Qceh(W-p@r{;o=&uqS_n}>nW4lJtR_ALgm8xVgJ41(Ks+NeR zFZ%UML6MR>1F+!~eh~zeOWoDxRGOcFEhzbap?;!mA_I)N(-f*5Wa#spDGU z3Fh>CdOyuNEHay*mGr@ibE_<_HH|RnnIE%xeQVGbp`_E%d85PA&_le>1J6Q4qFrlO z!Jy`liFaRU{Z2CxW_RXVTxvObOq4^VXYFw!B#RgsBjQ~TIFn&jR?QX;zqz@Wl1F1YlWBeEWsWBJj=nNkCOvK(k4cYPWYD_ot+aYV;7X+7 zI7P6x_gGy+_g3`nI=j7Lw=`%1U8VKSmuoph_9!QjQ8bFKc-wOX<~lSTM5Q+9W4wZ7mwpdC{~$5n#h%3)AK*U6)o} zdv&9DlP<~!DQE7Cq`u!{4>sRzV+;O50eO70dc@yf?>A4@&M&v|J)0Wz{s=8dMZ5Sli6wZCTqbg1 z?BgTW7>b_5IMlM(w#gCOTmjKko*bhE9Ko4htrr(dK@$AH!&{6=he+0th5;bg-KOZ98*t1i7d(5%nP=ag3FOAMZl+T8U$4nc->{a?L;C>flNRi zplitg`cJtJq_-!%{+56LU%uB5P9$3L+j40a9^aH9M%4`By43^kv@=3>r~GEIdz;(n zz;r8t0AeUIenpCf&ek_ zno^0AIi3)fg&{*e~y@EJqFwi!ipU__DEJ#qQ-16{S z|DA|a*G?q5O0iV7i(~(D6kl4E{cEYy_BBE@==cV8lj#gjFUXbf@>n=b zEJMbnZqy}v!6f+6%(8<2Y$UwDAFi~=Q&>wt8FfXri$1iOoABPdws zqp4Fuq@c@$;J8b5){re~y#^Ji-qxefjCD`a#-j2dMgkCus)7Z(^5Cq6TAati zYguGLr0DXY_ihR{LPF?m(?y&>3v5>+k&z4QeFnt0fC_ghUBafT%Md?QuNKo zai}G~GY-WHamRcpCBiEB4Trm4q!Nr~*^ zn{_>80{RM3`+JWeo5c%fb2krHP5;I@y)#h8>^)rSvV5H%^C7XhAmhoBj5M!dO?hl$ zBhL6Wfz5breR5*QV5vhDWmnw!$bGnYcIl3ZV_e{T-vLP3{=%$yj=& z!hNZ)8~fzwbtamRjIC`6b?s-EeiS)RguQhYmDf~jz_070-W;*v0~f)4uGx0kp^UC( zaV1p7ZL9Avn-3J>yfU*yk<412vaUdwZ9eQmInrKOwXeEw=uU<1nQMO#CX6;7sFxUt z)8iQE_Z#0y9AJzaDR?kku5*h$-zv*Ogs2TwOZ{9C6Ukjz7SmxEw^}zuoBQPlZl9PuT?ut@#>I4jtKjOCkMqHdziOPd>sSE(3jidh}P9 z&>ODr9aGYG!0lOlqs;yTgX-HLYii(20Dr>&;*%fYezh diff --git a/docs/images/mqc_fastqc_quality.png b/docs/images/mqc_fastqc_quality.png deleted file mode 100755 index a4b89bf56ab2ba88cab87841916eb680a816deae..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 55769 zcmeFZRal$t)-Fn+z*nS{Vx>rm6qiDAOL2F1cMtAuDNvx0;#Q!zyE_zjcbDMqmSlzR zn{)pEI@tSUUwdu2)&Y>bJb7fuJ?=5a1EER^lGqq;F_4guu%)HMRFIHRN0E?_z5hZ+ zJaJ}X&O!Wm=At4gf>b&}x`%l4+)`Lx7zwEYjQMDcig^FRNlM!V3F)=#)7P^V3xFpQ z(!7JTn6R3s!6EcTteK|QPPjx@DDOv5T2*CXB}Z%z@|SP-DsObzPh`FaVcdV&m0)j; zcZ>LN@}*RhsyUw6to^1IV&KrBgSL*D84<+V=b92tLUGmkCzrla{Dr!*h^X~IGAQjM zyD9lfz=>mTe@ql{QdCq_QdAt=(BA&2YBUsY=dfzD{{p(Xxaz)h;YCF8?Ul%1e}5}@ zO@0yZuh)nND%kn8|Na%lH#NLM=KqYOnC|MbCw}whr}=*yP7H-Y`-r9qwQ2rq9Dz|0 zBdN65Kl4A$DgS>m=QkV7|7=EzGh^Yu&HaDh$NCi3wnS$c$@$FVUp#HFss7?l0LJ~{ z!`SL7tNPPP=8^Kq8)3(i@(qbit!IaRj$Duu3h(VXaI4Sdu3~_@H&ak|A1shtFJP;$ z&Ff|ziaT$FS{aiU@Te#m;Cp!+I*IbJ@XxAqIeeeH<$>FQ&-YdyTH@a_&X?%>7*prF zp2!e%;=M(CLssc(k6U1h(+Z6N7fk4b1$pU zx+k}@k}uu*?&UWT+g}Y#gV?3_XQkIe!hs%Suq9Q))|Tlh`Wr-J#)v6)bNt9IQZ-?zd%Hw*=ZrCzD^f-D3r^0KBi$+ip$`A6Mk<3rtrZFNxAf zKk90T99Gb#t7ndaGJ(*jcpaOR-2zFV|0MH`0H4>cX|8kH-A>yB@PzO5QPgAAeG<9~ z(7IdVikhJ^RFhx&6*~Cd*30U>;FKs>ES%nYuI$%8RM=1({ChUX}X7!Wu zAA=&In$O5ezi+pM8LtJ8`oW`oa28+E!&*f>9{W97;k4XXkIS^H4+UAGvZx7D{UOIK zH$}ZEkpj2NC%)GxA>My-R{)`xdTyO1fcg{J)!T^@lJhkw=vrQzj&$^Qa(I7Cu2xl- zg5af(2k=sEQGeBmBNF1c9B_MFCIG7eR|`T^)>Jws({-d$>S9rNoIs$o1qKW1U(s7gPai5(qrX(&Um zwy;AI@AZ}{%d9#&PBP>zwc8=%jgWWGH2jQp`DWYPw4k^T`^Nvelzg_m4tOygvshAx zSic)*_56B2$iwR{sdtKA-$NW8Cffewvz4#abf1JwCg*y2X*Lu~6edkmydt&um&!Yh;0Fgz!I z8S zXW#cIlDgIR7Kgd*mV>IL1+VdR*KujmVe6Bnrwi2`nyj5h(N`umHB#h26X zt}BBFa)TAfq5C^R?mPC5nk4!GljuO$+PG#|*B4a_2>^!?m-qb{I`I10^!40&Ah?Xo z5pt;rAZdrM_}>Q86li@(J8)D#f?(9Br`@U}FA1>Jx%%}~}bmH|q8K|Y!jaNAu?dYM~6 zRZJc^eBV;Y!Mnx?kn&2<<#2q|Pp)+P>ZBPmqA2KkX?Et2s&9LqBzZimIWVsmGYatA zRXt~RY=fjB;A5x~rSrZ2e#S!_7>vCGqC{9lj*|V8LTb}g!H@mpp{+Rn_v>x&(6H+J z7}nKf@B4Ld%Z-a7|M0=og<;D>XSx@Y&lV$4Ekin}o2SXK^<>^M{r+%K-I&?XE$nJSn(xJK4qrH|bnqfPU>4jm=e=x!oc#?Jke&g(g- zUucQtw<$SVY?d~P}!t-c2Lo8mx6d`@70 zvP5TBSUX%%C7-WOwciMN4WbKqP5B%ow3f{Z-jx6kgNKYV|^tpbL^<*qZ-A^30n?FBY*Hn_q~jp%0Mg-<>UCF!!;rL{!Y{b z*3Cv>f1?;licgf`G`bG-zLl-3R|wc#Q538g0z$S#C86oCbHSjNy?ANChiOIVH2rMI zG5nGlT3Axtm$CYA3AoOV^jpuMy|ROZ?T(T^1UI_*!$t2I@DM>^@!2%tQ*2Px;zGGh z02fo5-BK-N3cz|cST76mXYkO_egPK}#MwY7cUixalk{5k7n=LGIBj3hTJKhyeXzl~ zGo3fkBcT7$3Q6oSx65M@pbZ+YC;(b=HY>1%!!mZp6Fqznq0rpI#0pXZU|dVnIlk9-%u>~`h}VhYjz zmPod{6t5ndj-zKD=!WOo(!>9dq!*2ld8_8dca!LG1x9m|yPCUXkoxbbV)V`B^QlP* z2QLUMxOI2m3%(x6c>7K);Oa-%C(!K#N~N9Ef%3qRq9J)~x4KpV>itdW?%7A43LDIa z8X^^jrZk!ojDyDSMXww70zLApJntoe%=xcBD#D>RDy64nfaU_M6Z)d7V4v3O7+UfM zI23&xL2-PqOi$oj<6nQBorePGYWBHH+x}3PF;m>1({p~`Te}(*tYP8JcKw|ZaIa3W z5|KeaW+a1}*~V9jOh9(L$~YKYYcNd}*`l$FOU6yA(HR-(cSZ&9*~&v1R}oErionDF zkmE|SIb~(H=VJ$DZ4b&-CQ)fO@a_a4)*zSnmv493+6k&S(%z0p_QJ>psX^O_V9lhrb>BAr9 z#!w93wGILaXkvaRP39@H;n)|GB8ih{1e-l>kB{FBn1qGHL%+#NzbvY3$Xf&5Ir5z2 zPG9!I*3-qPiSN%$8O#PHBV)1VD}P1)O~7Dhj2?72@pBcduzphsN8H)`k=p3Wh%;_$ zOeXLMp7o@Qaw@rwstN}`?{)X08s5C`DQlRw*eDrX7{@P}7d8#NUz6uvKJSkcQF?Ne z6pViyWiT|=e=Doa?LjcWpUG)555Bnx)chgcgWJ97&2EQZf!xal z)p2nI02nbGF^RF>u>$hlk&33=WQ-^JoI>Si0u8 zV07Zbz#>r^qAXD{lBu!00RKml^p=Cv64=~UMF`M+kogAK za9tvbFb_5Czmu~*!Wcf7X4}nlOhFn>z@2UYs5e8zXiDYQ=Ox))S3>&zy2o(u2h5!JvYvSsLq$lAJ%%c;J%Lb@e5mEkCW z?eZ|Dux0i&Si?wGLD+e^#G`KKbCx{u6gsr?6jUM?pE*3wAGiPuHc1MIvY4|WVosn|)%172v_ zuJ9qyLTdW=-$|n#8!G@V$$7Z3oifYzxs!m`vv;S}RV*&e|L#YrvkJalcR(jP&|ivp zdX?VXKmoSP&tSH<4&P*Xc=vJz77}8-1B8!d0cW#BxWLd8o=iJfUfU`0+(QVsx$4{8 zM%dD+!cq1`U^-K(q~!|)T~eLAZia5FB+I+)`mCM=ATeKEa>FyeeU0P0N(2$?H5_a% z1c?1K;t}s!d86fx%Dsml&FIN>)%>u!tJSay-_BD*KV3b8rOY0MRDF}8&W3rMO8Cvd zq4No{`UQOiAyeW&=;8TZg&{D6<%2^Z z!|qE6iY8+BPguq9y#O>n~H+h-giBAsF%%~f&;2z zHSJ9+elB|j$&@GebI=dtreMMQ&ghri{%!G?7SS%=%2G0KqHH#RkD(za3ny=Hi$(=p zLGvS3B|d!WGOoC}J8#If=~Y0uQMxBB0Dao47Ri8W79ysyRyY66Fcmx+Tm-DB zhy25cx=95+#qc?ToUlOnSSf2{HM2o=*VzYQSjU+-RrVoQq-g{FF4Zg zE~D2d*8doXY~?Q)$%+d%R^R5T*Ja|j(efj$qMbfNU$|`D4f(?#^kdi{t)k*vJRUdL zlxcwb4m#}66CTp`2n9CPSQhv#x;!Mn5l~6yO6GGaT9+UCvj-#Cg^PfUgy(9?6bFXL zpNb`ZMW&HB#=RloUUl{4T*WAYN0#{>9S=giO>#Fy+5dV^K*r~FnE~_`y9;cG`R|Z< zoOm=C`0i!|j9q)!?A~%82Uz7BM!4{L-9s2&lDz;lp6G%f*Hh2|EjuF*ZTdWkb~fij z6_P^E5528|&KH1y9o-vpP$5xCn_I}+iK{MC;6&BY+8Fs=m!-n;b%SD?b{UHjMD=vl z=|HehRp36=l!l{Nb=j)%E)c-p>$yu+7f<0NCv?~F0Cqtaf)`7bVV&u>BhZse9N&i(A3$x{)K4e9C)`q;|M{`52%Ol-Fg#F@RhIVC{{nI!7gqddBASWD!btp-(BBw zy3b`l5s_nR2<)6q^Y+vd*eWbZ{zSIO{;S}l*pU8|lJn$|PvBuKUqx7+=-R09e`&ej zfx{|HP3Z%AGj5jsR!`dCO19@yQ~>yvW;*!(X7#4zWHpB}1(BEfJf?t!{10!5-z-JJ zQX-eGqE>l9_7%!}cZXT{YORv&H@6?!P^VBI%uu6V6=U2bfK z-nUhXzIRgAtSRD^1sRqBr@J>`*yP8cp7G0o-9a4q`1%ZFqkHR25(W(nc!>F8Rev?+ z2p#E#0X>$-*t{U__3WWm|LRC(^ku5R)_I#q+`)twhDXu$zH2tK)}SV;F#zE0@2 zg?0JR?v@D90Hrb{11&%10Dztc$r&o2>~^QX>Hg!vk;( z#!o$oW+d2aJ3E!HTRLmi#ku04&fiTkl>~TQ=DSMO6nU&V@0^f&T|`G#xX*^A`Jd~q zJ}%Ne)$q(Ccl0IwAN0|Wt_{zb<)PfG{R#-xbxpIXTB^TSg|zin6u zSh5q{v1O+fzBxjo@#?QW1SARF$04v2_)CFv*=aWK_yOuc#x(QJ=Ett;&FUqs;sfxq zCIB|&O^N=5HrZJJV02Sr(xjsQLk19jeTIiI@V|PQ~{$B-zwT*x3pGviT$60%8 zCF!>divF-$D){m87X$&aRcy6G_WdbycC+L(o9?%>1B5-W24q|AHU&J)RiTV0+o^D# zT@WW6EHpXfOd)pp&5q{s?`;3C`S)0Y*FJT?+vbC9;6s04-B?QK(}F_(bAgv9`a9z3 z6M28iWc~@r|2+7AU-9?vZT>GSHUD2*%^6Xwe{?i5`rX!MSZEWDhZAtQj+cwo7%6a? zSLc=zv`#AoZy(3i_dRGaga;nDKI!IPS|BN(j!XSr`)E`qYOKB0Wf*X2oba7V#{I5) zk=%1laIo%)G5j-l9>dPfyf>2it=GmbYZG{h1;(^o*K*Rh-V5gQHTu_th|#qnsfD#z z@N=S0eaEKKL8ivW8}}v!0nvu1qUJx#E)FXw=}JTjohk=?^dIb7E2n>IU)7z^yXKN5>F_agCUG}=!;#J&CZeBX*c`T6-#zh=YC zndemokzv74zo3(!G~OKC6xP?%!8h!~ZNg_vh8nM8JRn4`F)hCQXDep(R~_D}48xI{ zy4B6+;dRhGlsf5MLde2Kp_-kt&0xj4>3R zhquhEz2pj?@1^q#2>W9fj)Lo|e>Qu;f1NoyY^u>Q{MwRUOwH>_4=8z=h;cgr9=^=* z?xGoVzo&BQKig6XySlGE%#IRELH|3M`R8%$1||7_>z7ob{BH;Pi(>l!kOxD5aw~vz80WD^z{{}CSKKBaMsdz*X zg6)>mlPEl1p-B3iKpQu{PzB-uPdhWO{u5Cs7TY70bf2c^q^bito#+l%nrww;wH*q9 z9^AY$9%^s&xgT$p@9X{}TC>IZXEuYUIBot@Zd+L=dt8Ib>xM9s`UCq}w*sdfH-c>$0J>4`lZ*J!KJWf!Y{KJ18 zO*eu+eRMMb1qB7s`&Lme!UCS%p^vnj9Q2HvZ-t@@!T%j}87W(a>}+UdXigJcB$4Fw!o$e+tk>*3^i~SJOF4C(3^hQo`+k zUHc7b-*l>D~O}$@DWtwNsB+WB=I-1wY3B z)aL(26^f6bcMLQ!gU#$v8OoT`dO;}%ZkQ@+oL)F*{Gtk~zA0_h*@O(Wo!zyFkK)04I`B2uMsXC_I zU!z7c!RhYhJk8D~`gE!0=iP>pQ1&?a zB!)_?vR+2ekCH#{3X(;%F)T=$KuNw;e-z^P__rCKy7~zHo4Nd6PA>hsiCK;Rkg$~!x* z1oZ}mhF_&o*#{n_Gl6O4`E5MaZ`8*?L(y-2KH65;x&P}1M}c~Nt(r)Z&EUbuGWgb` zq7h*-WJ2sQ%Gao%mg#yU&%gCFZGLyHw3wSiqxS1=ra7 zhfVM<(E_q=xL(ERoMH|F6v6KtK8Lk~#`=qi2h8)gZN zpyUxJ+PA&F!GFW~&t>#~6y)_7(HpW8GA#0Jj)JnO8cp|o$d$>=w7`eLBf~3W4w@?I z3W{(h>8dd`6ru&FGa6{(H&J8WF#<6i9@Pa!~XE?j?N_|er(s~ zoQnPL+2qvYPfp!VWX_=|XJ`LT_K`)B)Hpg6`5Jj1h*XuWGaakV^^5GAL8 z1<+W`_)7+Y9;rgWz7UMAb3^H0$qF~P}9YX$|(l68N)eOTs+-Qe#c_pox#H>9Hd=PVCb?037 zc_zYv+uwJQsXssy&e|r6osX(3gtZO%F+;}1ED_{DN(OKVGEW(OEgOHy`z;Y7edqUg zys_WA|GWh3p==edvj;U(>@0s)K za$RXeodzH`gT9(d)4eY`^}kKtGx+twpn!(!VK&>E+`yXpuh(v|Wpi(xTH=d7h;v5M zR!OVLI0!YPL@|EdV)~92GWb13R$pt`GEOT?Qb3x8FL#*Qs?^3PjDp30bwiH;|K&TnmI{XS_VTuIA^Xnk) zsnw>~BEwGBj$xwjGp_8r=GxpTbLY>4v$JC!E~~?Hz8N?^Ndu^6cq%-o7f>+JKkXTPIu#nTp1%Bf8oJEn+~#k zN$lGfo=h(}gTm<=NmRx#HWubhurWa9!z_j0mirhQKozcX)o-MCKS+U+)JmbYr=O&@ zqxm_+j`#c2m5$2FzBZCB1j*|si#Xvy3^!Fg04#vUxMh?he_JB87X1Pu^@Js}Al%lvRC}tTS?07wM`*eC|2fyacbu0nu1^PZ>k4AuS6p2pa8h}3!lXb z7r_gjW1#8@siJi4P7|_X)OLVfrXKQ1D=O4MjItz#=B=8o?40SD-1vq-P6EOgSr>U~Z9S?C>u(HvJCbLw4qC ztop8mY8GXcZ~_~n((s%NJy11JVUEbad`sQH;>i#eZ%GutbswFi`1%Pt)KH$zcr%DNDbV>DfG#DbOi8HOuFJpN&gT2;Iw>eOv}O#o z4R?4w{O&%K5Vb8@eB}{yeS>?T6RABQWkJM`{;QZIfGnGhyGq@IV*-6knvpw|-p9>L z8_Al3s`00QS`2aOB3S!KJ6PoClJHk*^e<9Ad|2h$i@?&-W7MU;?%kal^yz-r<+G^1 z3ePEaFu4kt4B8S>_b4Tog*3~bz8YIp2aKD9eM`&~kMoKBWiRy9>3*ex{3JikcJ}Fb z%F|>X-1Il#2ykyN?PknmKS5VQ>R)oG6|@i!HKt@e_*{`e6InENts%!y^}F{k;`8W< zOrqN3znhy>Y9D=`Y^b~%VAL%YTfa)04G_FL@T75=u?EDHHkKYcahGyN8oqe$#fkN- zL8ZX;gEHG~1>0NUj1-Y$rY3Fo=O%*5W=W@_?&iwRXu`HWXo{>Xyp@Hhxe!iZ?z&aD z4#nffwZ_Qzzrns#X;7I)Zjo{zoMhLa+xqy$Lg_DE<4d}V4`)a2&!Cd8UrIb`$7hQ~ z=rk3pL_>uShe-#nDQLLow4nimpL(^LXX95){J{Vs+#}lAx7hhMZKMAmM z@F@}Uj3|<`r$;{V-DHE@vA-qpGrh)EZ5nLHWL(KsXXqLi6M2tSeldQ*-*^A#+2(TN zh$e0D&p8p<0o2}CZ?Hhg*9_EEM8poNPOG1Aa2MN4ah2O+F;TTtw>uGr!H)Gh>J2rH zXFLlZh85r9yE4=+UxGnHePi3;6^A7(&UUa7E_@yVU?4Y_-Fl<@d%Quv-C`T%DQ|3``&(L^MPUn-q&sCZ zIsW1CvgOQcUB>3?@6N76^$4n~f@AH|@$r9Ikk}0E6n$%+>4bIhw}NC?o0k^zHGQCq zxp%a2gBW2V&eD+hK-KcNgv_rD{9j9$3M3nTudV&qOyVhqdTQ*bNTlgAZR#YREPi=I zfkqQU1+uZ!r~ zapTZw$fVK7r9vJg-B@Ml62+w5DO-4xdbOHw%~CT+&0R2hKK6+*aN;}#xCcXC8`-rj z#;6lm-Bt>#;*zI)V_WakvCNkFRBe|M;i6nIt8_Sqf)GD$y4Ebet;_EQ-h36+-}Hwi z*G}Fgdp~G<3==(#xp-|EIBy&Mupf-xtXVY1eM0f9a^eqffibJ*| zFeh(6S1byR5ldEw}h82UX3!s5W0g3eUd%q+f2x+?Q9?AJ$OF(NzRM^O0ul)+F&srRw4rpP9NNM zC+6g5Exi}AgJU;t`_6WH(mrCoZ3b*c%ri})d9Ihd2^NoS7gwNk za5jd{cQ*6X&O$wBl|Mpu%G zfG|V3AiCEMp;(0hIdu;xI$DRF-Q+5CzoEklgGPL8%wa`qXo-C(ae{e2;oprIn(;Y@Rg$=FML#BVB8#k+Rsl+tItuyeq~L*%@f2v&d2@{8TD zM4U=vKs?;y0D1T4AlMAjt@pZ4y~b5b@2%c%N=e{S-}#nshr*)&pdIT`hWpYx&!zQe zjQd!}?*!y1TmKrsOhSFkV0&vQpSUeJ3^??Yn_vhJE!C@OqdrT8p(8U?oK zh4%j8J@{vmM&n5g*a{t_Z9=H#&%@^O?8k?dY_{BgDp+AGs7eel>=}gdqYj%0RVi$( zsT+LAc6Q%axVf$PzQhzC+57B3hfK@;tUU~41cfVo{!Kj}NUffe)J3ZeQ!*z(w z>Yf&dPaI1$fq6}(4-q#NuR(Tjuk+8QT?>!Z%}?WO-j#B?w@`gzPQ`$y$X_?XzFGTR zq4hP-)!S%(Z9A9kK-iSIk7=8q-+i=TuFWi-ym*_>eUoPt=U@$W&Du0xolIbxFcuds z4|Sb9PnETL$71WkID^fx}bZ->Qs>AzZ!# z)c%0bGRnt2(({R^w`7S zQ7`JPVihS~JElzLcg&Jdd}{iZFO;O*+4PfZg117qLHd0iCL@#g)Gf`g%DXKUr@=Yy zaQwqceMb;fi5;K|T|B z`ANT$P7xM#`E`EtzTje-z>i*~rOcq&w0y=+5+UNB=7_ZR+xavh$!gMiy9+D2V)I5) zXmTO4S339dDqho((|)vpY7L~`^o1fNL?K(C>SAW7+0tP}5O6WnD~RdrArPuwYBrFn z0t9YDTYbmUanM0m#&K`|H1tT-76<{b^1V|*ZWLDqsJ;U0k+kIi?txp3rqAApczcKB zo-dSweIHV#%4W#2=aTn${B1Sv+UK<<0kN}qKR$ZB4bCuBx0k6_9x~vVoKV+ z&(}WQ=Jfd5nXXxN3SCvQlpXd}JoI-|b2eC!WgJd}PGeu$0!A_7d^#zIInYxi2_?*Ae@&^G z$PDnH`PPs*7BM*M79tWQTA8;<+CjnjahNS z)TAw}dr@;mwFV9luiSC7%1XKG3xtoE5sB2~ygqfPHmK?D`3S&-UbuAZDCpu%&f(5$ zZ=tm6>C+h!4NRlD7~_9!xK|Rw7kh7$EdN8&O|Q*;*ZCaD z4jJd=S~Xv{DiBm!zi9n!b0}i$`%OoeZgb9z_M07f<{%w$=I`(F7_&6GM`$zITB8MB8N6Ln8`vU|&v^H% zzlI7CK3Iehb#r8caRv?DU*F)1A3F@2*T^{A{zQd`>S=|uUQsZ&KA$%6(}JuU$Osz{88r^rp+Wi2e{`0T9QV1?p4 za~L#5T~1-Vhe|5^Tiu~ICc2J`73V*Tefm#B~4=bveHUwyMjMBL|;cX%8)=8 zoFo#i&)!T+)w-21=sR3;km9s1*flcnP%RDC*F=Tm+O94aEg_pD%leF8vta2*Az+P5 zADCIRacf?WQ5yN&B7R1q%5=w5DPM1NI*8FkNSjOkOD-biO1n=>Yb5tgEnr6RP3U8p z5Y3K}dS=;@c)-P$KCeSaK>{xIyvtA`@hFg}FUHmS*FTS48)2aw_y`Ge$ znPdOp^4YsOOpB;eHiXpO*`L}sIyT{J3b~>{{`Hm*>q&-6fwqLN*}Hm*SJZr0npYDr z?=PMOu;BO2GP-?w@jR;0&XjsqFWugHNL(Ya_7gUH7>j4_c5%P9E#H1=OZjV-#{l0u_)~I>-0fUVyiYkdf9XWUa zM1Xd3e6i;hJ1jx+30m4J7u2Est`0T%J8*(f$K%%KjgCZsHvMO3bvqCnPh3H|?xQma z4rSbdWu=z(`9a-Vy*y?Xf&ekh=h1@{dte9L4d-_~uQ60YMb*`Oc8Afv+%Yp?VF6=U zBVxaZSM8}7nHB{T5Ec5;B(df4+%q?_-G3OE5S=3EkUl8VV4L_ckv;LF(c9jrKJ0u# zcUAY~BU|YBk+VVlfiscRFj_~_Mj8R6yWmfL^BTYEytrmUr|}&luY{yq2gBhj`^c5Z z^S(cSkrU0?2?&(}>)0c{^rSVWrQMSY%$yc?UR!hrcSNmq+0&B!svJ0?5C~GA8}c>6 zj3N{*t4OCfKpu_^evK+tV7fprL3p;sL9(|iBI7Pia)v6MwpCc}&x=Mz?g403Xl<e;viOll%5G z0F13z2bFa2Hzg%Djq*8s(f={4DAR z_VYbC*mT3k8^YwXI%jshm2GBx>{5ieUdx1_gq9OvdT$5b@dmgLq=((RU{ZK6<-f+T zm}DK>i(S6*_7hf2xOTX|1-7HO4%Lop@E&^79{! z@9zg?%&B$Nbb{u$4&`iUl7ECne{W^Zt*<`qAxIkdiPu5@9OKNSobC�)v~C(0C)c zgd3@mu<_@wnt>uVJydQ~oz|jKOy0;^`Z?+o2D0^+hp!@j_=nH5zG^AYBuV|wimv<8 zJ-BGiO^XI}T+0%OK+mPa+&L+!)PYa5H}wL${$XzJBCc;XV=Co{g^!)F^tz?jpNo4b zH_VuCMYaCaZVyd48bC?#x#Q0K4CK%<=X&Zv)V@IQ!g5ZVK?zTp+C(vj*rq zre0*ZTR%sn9`4BUqa`iQwuwP$!iTu9y z*^Aa8nvPt{NV`}cy5l$vTGknczicBgdPa#+$B~_lxB0^l39bW-wL`u?WXo>LbCrxs zHO}TPn@o1wSYvVPGZi62B3}9ADk9<9rEQFD-?ViCJHyk~ulRlQ*z07+ zmqT0+dAd*&o$#ah@3U!@BqPvJ}Ns=MjBuIqf9PCEedGznEA@4tG^@#xdHP z5}hhW*p9vTm8p^F2zoA2iJy%YoUT99TiNM^!6xPDkXY%@^R6F7n4GGx+4V!RemOu` z=Bso5M|O}5LA6BSOdLB#UmR7s1}UL!yoSsl_4aP{66T2X(LM*|9)bk2fjUQG@;XV5 za7g2iD)Klhxr?NUp}g%l7S(du@pSRzjsod24a*3J?<_x#8}8QdV|kf7grum zMHRS^M;MRa{Q64RKHpz0W`#~YUyQ#oG(l?D10Z|E)=~C)c9e1bRQzl_KE8L*d#S4H zGq*7)2eRPeh6YhjH3bvBj1tQl|SyY`C6lvas01T(9PNZJK6 zP3wxPDqmT-KbA4>ntJkBD=r{uh>P2dKe_5iem*i@&Qi7(JIJESfjBKGU&VlMgWXOZ z+grrgAg-ko&vt-qp3qk_{Jyj{S5C8tp_aWI-lcFeqdCorB>t+{;r}X*a{YZ_D7jsx@3ZLF5~Y0 zEmA^FHl-=O@oYTk=b{3)f#6wrVMR^aAFkWt`K!X;*hkOEJ}h?qih1@jUzl5Auc6L~ zxmKdYX`}A(wIiw@Nvhre3EN-J<9T?KI85Pa#lXhN0pxf~!g)YyRJC$%aOPVO z1|N}Vm(EBijEx+5zwlamO7S~iGl_`D(3_AYNv=Tp-B zLfLb!LWW&-P|dCrm$Sp?uU4-Z9Z(L)Y`Z^8vKv;BwSQutkP{9P7Ks==4@J%CYWj*9 zM}5&B_xX$_jmo8fH#TZaygRjP#vD;JIFLu_3CL=zp!gk|koyVmeEXBMat*taN>zb& zg&Kq-YKy~J*#7QCz^h^O!Y`}mn!;bvx)sw2>M`%V$C^-PmWPOs%LdR>R9a zjk<;fPnjUHaeQF}hq2MN56#UAxS3c@3Q9#gOvfR69IJ)f)#IIsnP!H1MzFJ+M~v3H zm2atRwZuz(u=p#QW$W$iOXDKnfSyYt`5~>Wm|Mz|({I|E$#NdL=fer>#3u1y5dSj4 zhbTlcNm<$ZXDm5+&{w;^Vnmq)aShdk!HJ)q1*3!J?c7eue z4Ayl-cd=DH3Kr87G6hlUw+4yt%YStriba0x#%6h8yWB{-wpg`bEXk>vAuT`8CMCZ= z-ET)=GS~U_weHAuj!N8$QxriRCC_$2*OZ)z1s7+y0Y=tKL9QtIwdQO;E))*V`;X)q z!yVh(pIlUb7qE?K#Tiudee6%#>#9!n7viM7$pyuCMEsl%le^k_Q@40@a~s%d)S`(E zEoa4Rt!`>1A*l{oFdqaZ%8$Gp!HH!0fyIoqj-0fBJZJCd=cuTUbI%~>YWI-?Xf_iU z;p(r4yd|!ntJP(HtQYRCvJmF3CM-fcN?4UOu~xNlO#K4l9UutOL;i*TcD40HZNfNZ z48=KpV`9#O&p~l1lqXnxeu_{R(_Fy18x?Do2vyIpfsMNi==h3*DeaW9KFeGKVIEUk zFA=1Sbsa>aOw&?cN(-LAsQGLQI*QKv_J(QxZW9@`w79A$t3iTm_8RU}= zPk1~jn1_ubHVP*Y=ty%DSKZCk_LL+S4BZt3ps?hcWV7U@v&+g|tce!uuT zoaf$auXWTi2^OKA6T^5VDK+&=LRZ zh}nwN4f|Wi2H;M29qxDsS1;ds?$L2%vs&=*`}(}x?fu@t5*h?7mkz7o7{o ziz|$({9mgQP|Q^QNr%LsNmqXDY%h(Z4D5=5G#s8mXc;bGXjqNhviHGjue>Uo%4SRF z*bqwj7Nod}m)P&L4UmIEG5T06`^F6ydHyGsz7w|bSdf}FmmV{OAIoAn zvSLZ+%SiQOM*3+%Bp+W1Lg$l}=r{Uk#**4isDECH=%jX5K&c!$Byp5BG?w8J;=YkIeXoqkj znKUFjOl-m^nECRn!;La!Lg$gJIgh_m;Fm}zxFr*;hzA!C9k~v(P>w8rpF(hXh1ovr zzA%Rm`6u4?vDUSNLT~;c9KJVF;WP;$)M+Y!vNGWDe8gda@!UuX;bF}B<-Nf*2T4sj z3>#r!`)cWpK08bL@-hHE@LQROyQGIdK{mv!k;3mAV~Y*& zSx9%5c6=H`R2c<5TZom~S)T3I8*R!KE9Z zGy!Hum?_Ifj#-ah^FhR$lt)QpLd z4Z=r(dZzP@l^;2su|VZMmnmOEH~2N&6&pO_5y1FY{2%~AEy}vnB0qX?;I+BeKcB&f z|5-n=5l=bT!BIq+;RyxX6beD)7x>UAtobc61SA?P_ozwGiB-Aj_c@!Lx0)r0&$Q*; z7-Q3p>Q8fJ@t8ETi=ab%YjAt}qA~>G@Vs;N-`I%rADs}msjm0>eWY*01Gn@It7Gr) zvfk|JHY~V9eI(H5^?}anqY4?%?)Xku8F<& z>_)a|3WD-J7>6{IyHJ7Ny`sr%kPEeFA5=8sz8I;*LW|uf$ijVCB$3K8y`x{FJORg-`CT zC}*oRScJZ^5!az4e_~k*L8Kie5o|%0U=n+}6MSoXJV^q{avZhx_N7Rh6~0qzf$Y&r zdu6)*)REIY#^T(0%7wuvlqQEMvE;#rG+58^o-`ukh`jLP##HQy1~6-E4c@rB3Pqh8 zDUnBX7mjDFaBO-{#bn&eWY$}&K#}-hW>rwhHS7<%)64c=7yoZj1-pKq1+iGlPBJuV zKWWI?fcdcbKl5WJrm2fffh~(~uvkVjp*vVr(~|$L=|8=URvWRpUf6Lsh5vzbQvm?> zx`zl(i*xr!4lxhdG3~Y`Q1gGiOqdro9<4s_DQ8>s)cb318F(RE9jSx=U_oa)!&<@6 zW>xI-V$Y4~$-l&cpIC)?eD<+JdcA$LeW$*9XCE(FnjzJSg_7=*jN^W1@WeUBcjDH4 zDPL7o!srDPfz9aXRG;qPXHjo@CM^=WfXt`E4qzoma*pJ40+uSL4biBj23qPqe)@#A-O+O882J9sS zx^ICqC-ENXg873a)hiL?Yz@}dc-2eO3P(wUqi2Mlig-`}Xn^2<>c-!c)nYA2ANpSM zuX$`hTok?gLtX^Ds38~f)saMV)hGjY49J#-6JXcd)fmPuT>MU&!;gXb^H(>&Zpei{ zD6$?;nhRf>Cl)J|l?%H+@7`H_THjT#q2NZFv}4$jI?{y^AFw)t(<3NOQOC{@uK$`a zoPZm>!1K=HBz(h-CC8)qCeFF)q=Y?4W0+Y>aYM_;Ck3GXj6bx#QiT@aGiN1BTVkl{ z$_soMv^o*z|IS*ibD=5ke1x4mH+90p^=6jL+vCqdmy>bpw>AThce8)=@3y`C^n)S` z2As*5mQq-ZofZMgl3aFv4EY~!kc=DVgPk4%_|XB9(t z&pkSvEgC-Fd2cJ<#I~D^+)wy<2|Dc}KteTsyumg~<4T`RTwO73uT1x6b7?Nz2m-zv zqyOe#?uynui^nat&s)saS#K051fD3HM8_dfRsv_4@!qD$rGwLBE5@Z2j9$ta(Iy%Q zyI?(ek&`*!o}zI)2_mMe+s^6{Ncvh8eAY-1@6{vYFcn>k8*Sfm zy$cr$g*55TbyE3$Y-}MsJmS0A>(>=$`3LA|Pq1!y36T*z%Y;3sBPxQ9<3LzLbMRC2 z^lI6cc)`I^f-xhbbhyc!6GZwVIRv`9)wSdf+(mLG-yGJyMG40l%UHu-3#%X;qlpQ4 zI#_zNF=lp0{;4(>6BbnpqPK82Py0fT!H1JSM(`6+d>88_BgyPd;`e|gGv!)&v8f|h zKFe}=GlJEsk%FxPR7!jXRBNR>!wcL`rav1Gca&M6@ZFqE% z`4Mh^%VfTB>88(OnS}XjA%!~1TgzdO3p7|7|926;mpc4??7wq26+B<|^nJ2fDzywu zFo?l1EdtXHOpk5ff@z1DS-<$rG(ZFiXuFs|}Y34Kpxiz9w9v)SYh`Qlsa!LK_OFPk$W_-wQcU; zqnMAG5Q$Prs$WQkS8`znPLX==kuQ7CiAW{Rl1k9zUL&)gL2Ky%RI6%ljx`3Lym78HOG_r#NWZ`h;UmT; z8Q;NB(OjT-ypxw`C{7rz=Ah6?Ilf*d)0!r@p+-^-rj8xi z_6SQ&${Rp@207;QK;#<376gviKcGm_O;|y6$pBqF&Tj(sX+L)PBhju%zN5&)Py{q84S1 z!u8GCK6^gp(|xu;h?PPKnUh7Lmhp+RzfjWm!UtOhw9(KveIW^uIn_ z_4XfElclN`*ZUd3r=6|g_*_mCYn{^noi)emliSaY^fz<49-|%;zdlvkVbJWlK+ewK zY*{HA(P$@!lXVkSTpg#-w&~WQVm=nA@QV~tjbwOd-7zb2C?(IOw{6?D(sBB$ncUFf zOE(5xIKJ9Pt&il#NG9BsH`1^QjnQt{9LJsje&!xuc&TL(@ zAuXdsJ#S?ulhXa4ohB~W21ju2HEmn9;Ale><}Dj~ZAt1pw2jd+HpPP}W)J-w1RDseHl7A;l`H-f zBR?QsBau>#e*U!E>9Dp@ArRa{F&#eiGa?C9X0D*u+HD^SnppyBly#h5H*jF%%7=!sw59c9vD zehhfcSO<-^K!2XtS}}-6ld)lbeq<@ttMA$#^BVn6O>T$3LxpcObE-NtEn)SH3DAgsjf%Hy@L@o z>)9|}Njhf6u=~m;LtCH0meC4`1j`X@*Usz5Oj(WAi)jVKP9?vMg6!#`W_aJeyzA9E z8Et=&jhAK;rplBlx~kENNni)V)@4o#6iK~r3DI>TTeDky--t|0k4HK@%pgO9xQ%UD zyh!gX7B7xtM3{)5K!6}U%CGpooZ#bwfJBA8TNJ|w2h=#+HMy)2qAkKu)x~cv^MTR5 zgRFZprT~ARVEa$0VJl_teYh6S_m})2e(B2S7D%gA2}!UY_BEL%&Tpl&tiC2nrB;xd z>BKo49MIQG#xbHH@XVM6HDxXHxI_x8HLWh^aO2<0Q|I4KOH9SCksvdzy{{R;Q_qkt zt6QqxbuiwIc%>4LsbH_z77CuZ(N3Eh{Hjl*tq**sjUxsbL00hB%O`K$_t@x|s{n4T zNd=a$$ae5z7;Rcbu!eQO`0qOBG$j8>tyuBKRunfzdwqI*M)DkXw4BTY9#k;h5lpSc zQ`n|Bngm4zP!!TzK$%?Z-G;AmCHO7HG zJ4a(MJnx8jrjb>P`5nQ+l}d5)GCk*Icu;gi*^oOINvafMb|ZIakvKmN9Bc9!zuX@| z8c!6fcJBtgI}cj%Z*hu}cIGcMT*eEDaRt3viG8Pz`YPlFCsx%E3 ze|0qp+oBM@_a-zIsY9^~(nq26QCP#uvzBLITT-Fz1pxTVGcnL9>X6Hfuvh0pCi`ERa%Md2+UxG~gfM-;9Wc)ekf>K{tXe9Mtf!(RFbeqz0o?=Tkh6Nvrj3gQ`mk*o^N zm!-*o=#C|``9cYa3e9*JN%R@qkelPrEPd#e)szjS?u45l-g~tSiv;RefFk~@$ll69Yelw0B?`5LzC;tmCJSyx_+HqT%Gc-2 zhqa7V;q8X$f6QtH%hylOT@X$Mzo#h71A{SUK$?cZ-d!_6boCTtWx6T|zRb+Ik5lZx zC5dG%G$-g=G*YM6F_`aAlH>GIDIqE;_y7oJh498JT}+&LXR4d;+c`H(r3h&!=?z9x z4Q9TKSxmY$n+qmpaZ(L5^RA7HmY@KNAqINP#5>dVozR%cDNn*ch4az#C??EvxggEz zsSOE4zWxw3&F#htFngbgdsT{RM~3V7uK!%; zSN!T%2CcRzG~5cBOfItKldRJy+p^9QA@i?}dZ znE+cDmfM=j?ciR(FH$XL?toJf-0P#?``x(7+V%+5_T&Q}4ryu>>On>|O2>w&hEpt* z5)Q%Yc&uncx(~56ht=CiOPu^_jEY%zk8Kpx8pu5Vbwy1^yuRo6Z{#hTke{V6p)&Tv=g`ZHv@IDp| z9-YRIOoK7?Vhu_H48|kcl8_9){<@Y7i_RF`qbV6-7s>n$_Pk7Q+O8Ny@3HclM47Ac z6zq|t>*>*jzQ1Q3l^j2@k0ZK+I`N0qp{^YV!oBYzZE5 zSvR>;F(^9oMiSA@_%a>wFdl#lN12STlFn`{Qmaf}rDn#9RS6j!Q3~}X zj=UMxLXAIWT*~kt-mDJCc)Cpz=ibFBQnyK#3pFG)Am4l|0PbQn#eT`Vij|AEU5G%h z$?8@IdZ=eNwR^{eh9<;Pjkqg_&CZ`Hvor z^fGvd$l6WXOdtBDp6J#m__((+#YK7r9MVZZf^jwc^VldYv>MnCwxEHmjCA-@!jTj?aPs5l^liizJ(^&FE1FpZ{Ym2#`r~ z3$WnCaEA?+aPxO%`B{1|`gSd*Ka{eb%NZ?ZKVE^@Xr40xBKY^cL=YK*9#^7FK>)h( zQSI76fgkV{B@bpHxC!faVCy9_0+fD8)Zyl>Oz5wZTeI&x21V>$btPM->8wm90k^yf zdoyGD<+a&Jz#pF3h!1alyPUX(tHDr~S87UyD+l>$24NU?oQO9D4|DnM<<{P-5v z0EfE~)@KAjemmaKTCM0`k3tG8krF!R2_~LbrBR2%teCVPh=veVmQB9mWCw` zRBgo9P5Zjdo9INN96~`85TLimeAWEwn27-7gW?#U5e%o(cE$*1-b}L?*H}@0i!8#D z>Uo|PP&r6F`v|C&?si$#j^150fj%x~5ONvfry{1>s%V^z?BIVI6%;awoqIAAE+1r% zr%okZN!tCI+p9joS~>M{6SzZ;3?!2Dhs9X!)6EG?W`;1=K2r-_=(Wi~M!Bb|OgmT_ z`2VC)SopD@PttM9_!%^JN0ir>nt%q^UFnwBe^6%XTT+3YDSb?Ycreb%B%%D&Nya3+ z2w8xJsD7FRj?pAvgW`tTb`Y4^yWJDg1&-?3wn>%6BsC2_CNkshL&e|3s0g6 zCp}stZhun&7%~}K)l7`s*HIU=ZT@Ig^~ciyxVAo{|#log(TGcqhFz2n>YD}PfA{!SqL*%27i3L zVt~5xwo(|dpyWNbTT%Xq90l-OjX0{cQ19gm4a+43;MeNTZ=^*pQErF466HVSl3n+B>}KhjI4M{vNuAyFoXS1WABDQ=ro#C9LHsinW@c$u zat7*s0VfDf|5M;;M0)rQl0tU8yk)AY$&F5i9w5cuIvS^~N4`8Er&8j=LloSD zIB@a!n7j^ZL*-A|ES~z_uESM3XAG>{e-s_b5@Y`0H<8?2V(vtNLcG>P#L70QDc=)3S59YTUZanCyxMgJ9IkJd@Js*GAR@QbFvEkyRt*ihX00jFbI`A{T@Hi7a>$ z9dv>9Zj5Nb)QrZRk2L02K06WlI?fU!y<7-R6wIRSDQm0??g)lKHj%zN!@_9%(a0V@-q0Y8JIgQw0k zW7KL3JY)7Dk5n5?r)jU5j0mN7vF}HdGu<)aLXMCHNd@t)OBd>dOcSQhVqu3=2eTsJ zgNs889adQocnYQEJQ%-no23VQ4pIz4bPKzPwc4-DLBR#uam?%N00hJ1njr|mOjTE{ zuR*ca{PW6n35vM9iK!*t8#DOOToBZaHj4?8k)~387a3NBLhj#R<;uK?z!bpJAS{wMPPYv6QFvJ; z1pm(5kCd0#WeWoFpwEhy?MR{TpwFJvXUtWgmeSGOP~>%i;$uC8L4s7CRaGSMz)fV7 zUH@X6>SJwD$y@wy2ft<@D9oe0{#fa=1O4+V;?Bu0XBj9@M&lTPmY1jKr%$u)t-%0H z3-xW%={G`|GW$M+@#1R2?cK`Es+e7a%3W&Y1={ajI{pp38a*BZf*cLMk@lcca%YXg zlb1((z53>tdl)5ewLO~{@W(aPGbV;*m_@yq z!qTY3JAN1dwSq6%J#P}Te0+5klVk5cW$!ppnl4pN5rBxnk}NjD;mr^O8WxI(tuyk`0_N-ZINriG=?|u0V*1~khV8VY1|dGfHsb!! z+(Ui-?Et=|dkl0Y1P6cph=LaS8TfA9T!yz?PpqW;y^36HLg)!o#r+qiEHMP~Vi977 z$7(}MP96Xy$AJ4j@)5S$ z2snd)MC1dM)y=FAI%aa~((I9!l;V~J2~%)Ps1pnWdtN_h)#4y1#Z|)Fy9R6MzFoTe zsG`5SF9Og>19#F$6A!2U5?$CmJUloKIWH2K!Pd!8Gl`-1B`tWbEj% zwiRkjD6ZDTM|sd?csJIOZSX&P3A_*kqq5%5i_x!yzuk!p2uJdXg!FMp@@_6aB7IoK zTfZ~n1_C0XsCgX-MJnqGCJnx&_GY%K+A@wwo}wu?zoJ5#%SCTshjddm*NlVOA60_o!t^8= zI0W__5IW`8Nk&UmI_i37>*#cFxlw+_lofMOq0LpPidbt%JRf+;51US0iZ2wkzhXBU z{sXo$ZRM!4y-fB)6GIa>mYK;(pHg%hKn`sr{vXS;Aw-_P)O1OwGV)Fmp4(3wz9Z;JL^LazLgBqs3c>31Ete zkvJ1G`mg2RFVoXBnbHFFXWG}DO5nA2ddz$^Q8rNcLw=sroH}ESu(vXg%7D4dr20c9 zVNbh2>kz^V5OkSK&mtMk#;7y~;;>bHPfBU~h1=K)Dez%9_oT_M9oq@hXPaCI-KAEa zu{h^qo^D~8_;yJU*(bQ2%Oy5pYPXS<8wW+^w*v_EnVFo=7Mxz0CO69%AvIkDua;ml zz0U!d&tone{&(zC2X!Ary4j(iv_c8}woL+hqX_34lAb%E5GR|RK3+PiU)tc&EO!lKt<)6Q?q{01?$TSpi z38`d+Wo9~JQFS7;L2m6=S4)!eGXEzn&)k-^*? zd1y`4oT}4%G%!z%}xCXHc>M$mhmTVAT336kckoBel%Bj z)&g8&jvAf@O!Xhv1y`%@vuHDzBU2eIKJHE-d^ihaG#+dinEZ??qTvKcSlIFl81&S% zoHEM=3Op{yn%GAlOe-^MQu7mA{UvC{^itXKzvVGn(In#i#7D#%-g`5-t%^txqr;ss zRa0U@3P+4G!CJk))@m4Yv!C;=t6-d2%gT=&k-LlU|HZLBjegiyu>*aHJ!<&T@twR$ z^k4HAr3$u8`D~&vUEwT~q%_-kU^k{QgYV^l6xU@aP~?)2R7Ni$;PRB>bq>wO4x z2Q47emNCk?Js?qGe-5jolGaEsMPNIPaN$dtXL$dp|N+K@#;;e$!}L;e9} z9|)HU8%z}N04-t!fy*cV-| z&}2yI^chFepYwSOh4h{7N6VIfD{fU8et0cv8q!pPWz}4dDhN9|6I4wEbU6S->l0aK z?`%!J%XqGI<%f9I^uH^v<41c29XWsR#SV7|oO?9xCy>;&NqxDJX*3)v0PF5mQe}Es z@{;McY=s=QsWN-j8l0i~VYxwu_RW_Ls(MO$M{F8D_^*6~WTdgNv!&mSpEEAgV7HKY zTz%Wg9D9(mFuZm&NL&x$k&5rqgW!Yx@a3u(zOIv;Ue;XgsP!R%QYvY);a(757zH9- zc4Ud;32BE97bj;-a`!?>KVi0llNL>XV{9ku{Qmt2^8w^JR*d2BdNFU}#jr1+?>tXidnE0BuK=S-> z=h>P=fbRnz5T;}T#2o|*n;igrz#sHq*Bq9%ys)H0F?pyPCv1_YM@pkxZGk0jT@WbQ z5KDokY=z2KTuDMU4aqZi^4=l86&mO^S~CWqFJ#i%2anIL^fydaUH znXJV@%IYSNofgsOQP}Cg&4d09K3VJd-5y#GZ}o0}XOvHnK&sdphlZ&~#{|6}+ePr)l?$_|NKwLRKN(BdZ3 zo#DJ@U=>sU752Y!1jPp&lbVL#t1ET51sA7t1e0$u;%X|Ct*=X&mew+NwOB)Prz=`#`&@WnIu3xwe)a~C4 zL3v7x3@n3V8V#$U@_G!`_`vmnCMluP{oO7rK%lLl3x8yU+u<%d=vI7RcD(rIYmub< zT~sKdn`Pe^#RKp{qrZlIH+Iz?rGH+&5V9Psbt{^s~I1Ml@4D2Us9a; zf4SJtwo@OBo~(qNojBF^%Gy!d?!UHHei#89mXzm%#QE2`WDj{{{~$+0LOqi*%6P%0 z%3*@i?u*OGyVk3B*A@ywsLuGBl2XYGDBy!kJtwQF*UaS`^K4pW=iof1FET}khs3Pk z`NJ&y!b>98;h~${_Too$)x{x$R6!8lWcpKg1iM0@TPL@5L~j{1C5nuVnU4R5xHDw3 zqy^a<2LKeQ&$;g-_YXS^u5A2l7-&=BGi7NvGn(RPbh&U4IM@v9x)hMm*~+kBFCBdP zu4W6LX$?j_MX-4Jo@9aOZxENUak7i;55J?NPMBy`KM7T5ki?o8-nY?+u$qaWER8=g zX0`0P5AGVR99*~Hw`{`*p!!-^knJK}Mz1=QZU%3}(R)yvgcrj?|fbhq#uk$67 zMp4}MhtDq#SrBar_6ynA{zL$l`8iMX#AmJRP2+R3}^5MRaqpmbj8GW4!Z$hLkza1`zr z@k1u&zx9zVlB`!`#B2Lg5tCAMDrTA+UfcW6Nk5kMr}E;uAB)ID3+Z}V$xKiXWLCGu zb&@@Pb=!WfDCLy2e{fUTg0SW%7c@zmHGmJkn5=1dILIl&6ZLKPV0MRz{m^T^tnU0UCMJ`aMmWMX6AQLqmL;?q?P zsbsx@f@LdX-&7D>Q*qjpw6tK(m1T$qYAVZXr#d;VCrG*3N1uYBJ$*>h8d-xGYpn=o zUXj?>QLCMN@Z(K7T^8!Pfq%bg=|gHJDV*VtQ|Rre}=?E(~;cSh>N0a!&!`UV$bA_ zrNERQ=kmQr#)YKfW1eZN?^ZaROvEf+Yg$8b;+I~$(Pc$u*9{X-G#3IEkEt*`$QSVIog6J# zA`y-Qp5M6VpbaKYFu}LMRK3jUvBOu0mF2z1`>m?1rp5!TB?KT<)b`${2^}{Z=Kap0 z{@V3UP2Cu&xngy8UO?MRAL3Ui;OO2=NV3gbgfYwkP86@NxCxSNd?D*Z;Zxl1p2TPq zrfV*YYx>zPG-*J6HTk{i<}%v5b&p^5)+`-ncA=7+ncNZE0?ZkE3V~-}!vX1E{LVMpgh3KmU##d}~-$~?0L z!|)PA9W6o#giPgsU|Bd3WY?@A&mz2kBdC8gH59E4D;y?C1g*@8X)44>)LvUB+KSRrZn=Pa@>glXfFN%iKv9F#NG)hABKjwmrQf`7$ zE^WH##}=w5_T5xu{lMbWSxb-&^K6pkh!Q&d0xdri^MFOgdH#*LE+|n)iWM|pweW{VTV9CFXr9w? zT@lQL5&`5YX#i=(c#8(v!80ed^u*m4}!_GKMeCmXy@wwvgds+K#6l{NU|Do5{(O1B!Z{bv(e>!|OAEauS zFeCzQ!T5<^)IA>Yesp68z2Lp{xE_t0@12s0l`&0uW2#aSd@}jt+iIPR$@|wAI{##s zO~&Eqz$0ku7AcgPbRy%=czUPh9_h?#Y7j1-_uwi+$vayFT~X+LPFx#MV3UgN7xq*W zdRE@0<>|@hX2qG>alJKa2Lf$fQ{-%T4DfS`J5Uf9P!LYt8I`KK-+Y^67+c?upqH?A zbu+jCX>IsTy&Mr$c#Z{Qw{IN)7_C$@ll$C^JjFaM4UaBV3d+sjB%0sMUs6dF*N}-xms`V{CaT%m*h#p@O z>BQbq6`f=qyyS0ry8-B=tf6jBpPis4XrLe+l{eb)ECZnKA49`I8v$CsCnT;z#CU*a z3rJ6pN9ZOU#7HD0wcJsit~-$nq-<+5xq1!z^C_`6szx(sQ!bfJfwoLDM^!hV!6YSJ z+0L#W|7eCMNd}#2)Rrn)R4P|t<_mHSDlSf8mDcyxcR%pilbomaJVaG_erwu*dH6n; zqfkc$7&t{y139)h%fUV|pyCnKR07)+)&mzNl~E!yFB_feQ(|~4lV8CVewB`IK~pJV z&M*5ev^{b(giYFsq`_n9ZtN>{C@9!j#P?p^RxU&>uHm3yb=kO%=F>&qmOf-m(WdU_ z|GyTDdlZ_dFE9Y<2rhwQ#LPA(L4NcFlH`}C(gvI9b*L6E0yhqi4ydqdDEI}QbYJ#w z6s3BOr4oJ1EEBU=s*~`r&>xDG?ao@fK z-5cUhSAgf=s%@m1wL)&1?g>1;v`GxC45skT;j)yN7-vDMotdI z3OSDKnsivlGMbhGKdZ2B)r5|NC4od58dXW%bW&>Fm^=Eey|!iZb?s;alW-ume{ME6 z^-@gBV6DY|joezuIF0uoWhvV7FGr*jd;7XXF#8r@)E{3E0EdqiKw}A+tfszOT1xAM zI@Yp=1WjEk8mu1Q_};EU1QG6i8p@7^)KpTH<|>_KzF@VKS?)}5?*^>Muh{Dbomv}C zZ)MM%Wl3xss_PQ69Hptk8=e64H@5$<)w6K{ka$v-q*jkReP%Hpze^vX@;;S^oiF#p zP^ZC<|BZbn$a_rk_ND!%!^nzsbP&HxMfr4&>`&zRfbmN4n7}mH0brX_P`(N#XNl#< zmlf3~Eab19m+!$p{M;v`C0hYbGa_hx+LXnSpxzr-XRM%bQN=*EL!~-s>=JoHgqoiD zmVUtXU2Q0#koE<;u(ea_d7+7=)KNo`nZe3H+js%Zapby%dzMdg8Q?dPc>0LC=XW%$ zA&94IY=F+HD-W#y=xdOp2alN6y9Fl0=p-sQ1-ZEslOzb)HC zFhk+y8%GUGuIY{$8=Ly=tk*N+t09D{jR&g)Q+MN9*#U%VFjBCoYKH{i_rn4lrfa>o z|Ip`>IH&N+O+v3&tywmNYXlqo#0uK=MYXTRWm&c7fih5AWF1K^{7`h}&tQ%WMSXlH zROqnOkl9@Ep_(hq0c+Lm%78cqD5!7Hhd0}Sm(MfNEQPfILeGVu3nP>A1{j(9C!*9% ze%Y-f92R*nz*5!ps^FtUL*f%R2QFQZ?qg>85EhKo2PkKZ?fG5MUQ(OS#3l1T7ru+F zj{*hHy1JjQSmy((?D|kgxB4pGy3VpoV$y(Rb%Ou@QQXk+LK+jk1>2b~=1%HZh4Dy`vziB=x^Yls~C#>020lv-;?LpQ~-2kH;EQQ~}+TdG)vi3@3};f$5i3CQ3^ zYuR*OoV=rykE7K;8F2*>kUmk|ppqG+Wg5r&D9;dTq!bzT=#>%e^-IZIqXezVLBrT& z@UWkNe@2~93z#=99oN6=eT_z!x91M{2FA`8&61U;EHu_+{`Z+zQ}A4Ix8FtM{{Ptf z%BU*4w@*+36#)eWk$R*XrKLqWr8}j&J5&UuyG!Xt>KwYeI}aeufkSuCMxXyXGi%M4 zS!>pOdOykWu6^(O>iAtNOJpgMtw<0u=ihwTrl^KTyoGbW!|`F5VD^;|{;*Ck`6BwK z;R!>C7GoQZuIm}L!o>aW6XTd5)NV}ssjS7%Bne6|c$O3=(!|DcO2obc5h<%vtQa7IKA^Y(eaz^nI_J}jXD6Qbc0+zw*m zGAIlpF_r2+duF^JU?lZXDB#CXv2-iSNV9zV=2n^iF}4MD^%w0|x+=}D5%*+(Z+p)n zGcHG)kIj}gk@-va5Iz_UmCi7B(sM-TG9gZ}QMBu+aG7*L>S^TK`ae}ldtf4`t3`*4 zS+Go=c!Y$kP>Ok=f!pk;I~OzWHnjn_M&IKy?9^)CuV?9YyHgdXu4(;7Bd5 zQBNYajdS@nDLd2>L`LZ_uqL%P^s?e#6x`!(UOu7E#8ZB2dT(B!9;#i)q>$wuuwA^h z1As!TH~iTQ%?dE+i+}q5Ts+rXiQ4Zbt;Os7rw1K@bJs%jRGxR}QP$xyB(hl|UGzI{ z_&}Bl{<|`5m=#psfJY=E?{IQ)LLo3%Td_LJuKal7>!>LA_aF(-0WAGk`b#2n8oQuR zBXSrK%_V)B-RXe|Lo6jl_-`$PR(VcOtlCKd8NuQV~m%VsU#5A;sxAif^%f2W!v zV6na%<#KXl>0(A?!t>d|Xs6GdrDS?=5%hQbgnWqO&}rE3oN3R2{281Vn#d2EoVz@B zFNsQTDcvkO^}5C)G@p3%M-UpQ=)qV!vgOej0_~u zxVm?()qPlQu+IR^jSYtx)EOOxcHyV4N>Mx8W1m86nCC2Aq}jL3u;Zzt0>tq%$*_Zg z&GV8S1T?JU?YpbxzgXO#7f|@|2zNjV06!N&KF*F8sq|(Fg7m&tlTDpz=v;hi6_F}?!{@{|?Ly{}xL_P%Q^5Mf!3Uv<6(a-(z0BoMwi+9SaqTkg#>?mqAtcx z7Vh2pH*2+T)_C~?zp_=^DTZ1|e#lm#W1_Vlgs`z7dTFc5)y!=)yBXI-q93sE$jN)W zci(K*?77VK`%s(xh#R+Q~3K z_SwGZ*lrDT=#Mw+#TV5Lh&{A|&l%X$hAv(%Jbc;)oh`WA`CHg`HO0zn^yJ?xXia%> zY$BfiLyFS#=9dCN5Pa)_=e%*kN9L;KaGTbp9fi%{(1NmOTlM$WOpd2na~su$2FzP8YrqpiD@lmitMf1)uah)UIlDowLgx;4CIVWA`=~L--eODx>>w0 zq42Eoza~BAJ$%bJ8Q@=ev~=X5hW6KsUuq+grCk-ylG{ChyStG|2W^?vp5IkS1!|R| zJSPJ+XDyG$!`L6Bm17Q=bH6bt)CN0vhdsU=$w}W%*ORs^itINANY8Cb2CVGrJspQ` zb)d7%O^4T_1pw(B^m`ENeE5N!-7XZc0m)L83yNq5Ii!L#^uAxITrXC#pbdEI`eu*v z#E0BJaTx@Uo~e9t8hIOS_`46)_Yv|b{mzas8ou{kUhRy)ro0!yLl7r4i6TRolRV}n zz-b$y`%$$Iokcs&O|=MfK(P&vM=x10xL%c2mnubaFlTN1%ctRr)FX*W-I!^U`wo+i zI-^egAkap=9LUdqa}}h(l>NB8Yf;Z7cl&ARwr@Ayo=ud*FQ^{V<~}t`@2c&7K7)kz zyBVdYim}v8y6~A}!9RB7>w@1h#(aCtmq=hdK;2j1FUGnr_YR@HWSDx=ZKq)<6Hr6Q_OlXKN8P8$@+TzJM)aIEAUWv3 zRqdt7&kapo0e$O~MVW5fCL9lD+K$`%mK__~j;r%g3SKioa1-)p~6CIl7WCx&<1X52k`&E#vUN_LjxZ=#tYs}e7C}f@Xbwd?wN6I)TQcH2O z@5phbWfo`MPTKAqrfOkfq9=v|)5=zU=+cfCgud1f%5fmbfuHk`W((P-W)v1iwI)-# zTTw^evY{)a)4mqLo2YoA7YM3Gxm#068=i-tQ=<$RvO;o68E$ctQBJ1Sa@yiRVIdk} zL=b9xV0Un+?$XP$2Q1o(0S4>|1Npxj?(l%Ge|wek#Dct)dyLE%#oYoGJE@PoZ|C<; z@)J&;GVmBE7WbN<@i=`{Eg{7Dbq{hzio)Y-6WX=!z)WCDZV)D?Ctnk;_MI}L>ZwtX zq3*g$rM9E=EZfxURP~agWyVx(C)$<#uvSu-H&`7L~=IWbY`erWU!GmxK~32z&7iUb+4*)M{62<(fbyUL}X z;gLm}Me|4C>eTss;;XQP>xoXUeV5lBizj>0%{g1R)I0IYWtBK63}X;0EhH7hLQ8V% z&Om<@Nl(RSGmZ4NM3d2HhT)ech{7#I(Uv79d#if5Ql5nb4U;ciMlm(CS+y)@o4N&_ z{#9|!`p$5O@O?)9JeGu3iqbtzYq7Wpi&>&;f(%-8*3}2kD_Px)daZ;a znk{{2M~%;IcIhlz@B$u?f|ir$Ee}Uwu6A6X!*;bG+>FQSp%Jg5dz~>OjdfER!Hgc2 zT^048Zs#3gx&VRG(F35LS%gfHvX}iqLC+*XDfZHS&(dK__!}bD{u5%5pkn z7n#LZcQwzs7b~;B)y6MFzNeECGlF>$ce|L_o+43@7eQsrt6(qxD|?McH8|!+ zi~&PUPFv{vaG(@l1+Ui{n-B=zCyWgUsRQv~->GuKGC1xZjYvO^bI=im)K{aT(C@qA z#}k2~RC=rwBn4zh)Cy?h$VQQ>9B05SnMGgDWEh*k-}&|hnc&GufLcy76!=D+pO()y zOV6e(>{dC4K*$4dzk9CM>Y`JxWx|WBFFz^D&<{W;$)#;>9HC)^Y0^bktoQ4W>w!j6(8#7d2(>HFoYbWxPa;=9VaWbohWgh0wIqJUyA;R;LdJ;Q%B>TbjyysI8lR36tBt z*F(=XO&(Q%$)4OFQXseJpCeeXN$>+qW61gL^>!B8eBL!fr#{c7gZUD!vgLgBYtI!S zXjja|Ll6cT2_qA}pijQTowea`BG`{%3k?X@5@b$NY`xD?3ST+0FjMxUZ$JJg8^G?S zw~Ia13HUvWu(o;x88d}GgT)xtGEhbJ3XN_Og2@`3`$~T3kNiRX{E+Q^ne~<{-`lqr z{HS=iS}K7}2@P4>3@Yq8rqv9HtLpvr)HJtwVkF;*rWtefVj9t?7M#iwaZ`?h@=sv4 zwfFU}Ei5Trm~;xVn}N$)fwy;pv`aaXfTUMiW{s*NVx5xmAPT3tJHUh9NSUd%+&HY# zxTMlL&3Kp3e3wt5wzgX|WBPF24sXDiDOohs$f4-v{q{2Yiuo^+g*TFgl8lZVV-vqJ z7Tfl^6QX?fo4Z#GSaGz9l`X#EdP{n1-QLt(U$$Iw`J@aC(U!xf4@(c%m)9e7zU!zC z4}7VdAlTeSKR)(VGCPJQzMyDAKe6#Rvp^scd|8b3jk6U-jeLDjbz0~5vRKWi&9lSw=8yHd5Ypk-r=N=*>&*L`*@5vnFxto1Bx7H98)pfdGR2n=eWjXGX?eq@pEG%q4pLag@G(l6N7amC4vea^al|i&J zo8DR}R@#f7i!z1mpj9l$6W7y3u_#7*Ctk;1O@MHwe38G#PD zXK4WD6J!+7$M8do`F=p4;H%MORtoN>AL4I6m)cIUrudR*Z*#v^Lk%)SC<6O8lf z=qF5psNO-g+DoF4qNl#1s1Lt+F2)K-O6F$0n}TiVFnd0FZQuw7DND&}`x&?2VW+be zzom_~X4GoV_&^Em=ntJ`SqcO3YRfQCKr@#(V3pLi*Rls#8-&yhpP@}JOnGZ{I=Vbv zd}nWmSOJEUkv$!{Z0u}J-TA?XZU4QlmL)iRbc%RTHQM_$e?g0-YfP9o(q!~+csQI$ zK)aoBALEJpAlRWN8Ja5%5zs;@9Z@%L=!8y9IRmRQ-hL{9+*0rKv)e7a!eJVPt$%h8 zvxlwXPV%n=toc+k6kgGB)4uzZ16)oi(Els1D|9?|dNg+I;Kvyr2u66}yDMNz{W9!-8T&0< z9`tLV5LKyQC`jb%NvOiU<7S9Zx%z-+2|nS_vTw@MU-zVdrvN5Yxqn*2m`yO0H5hc< zo?Mjk8+8TMg;C2?Dz5B1Aqd_vuUx41yZq#^ROedQSyiDr%6|oXUUOqQldf`eBe+=* z1TPO#@lWWV%VIh;asl>;g0>-AZY#M92GUD^P`#CM{+3l=v?B??h9y~ zMbgEK3L|ktg{6D<(H}cSKkutKzK<>;y{_P=omYFkncFbMmzW3essXsRB-@|bErFiYvPPVZ!)vc1PQ;Jo_0&@kl0D?z9*FXtQcPj ztMzyy*Xeb2Z>yFNa}rRlp@L4rW1|zNHFNrboj@s2ULkLv-tte{ciH$CTWz48mk9vt z>3;gh*>45~RB=G?or>l4@9C)bya_rZli4?X!4%^{8G0Xra}r?vb}LqHx4`-lEfi1u z*B0crsH33Mi*5^f(#Zkxv0M=zRWJ)NKuSM`p!~TuZ)JF-ZpEN_Mx$H@R^oUJwq&PF zXqpF@7wo>n&Vy0BRkahDEeT^h_1*B*3BF1nqd!9mt0btk=9%&sqL0g78^dK&I$Un0 z)}&%VO>sHP=(L831;_M%{%hVcQo`WDr-<*=OcL+ER{NuA&u}OEo}J0LFz=b4z>`&#jB*MLq2J&h!&9@o{VO zwYu({G*vbgPE=Qxu5zJ}!VmFiJOnOx$?15~i*MoiUoSoRKq;xb{iFVkFColaGzrqN z@>(D)dGes>A7c6{*LM4&*F#VDg(nJR*}x2?IR?4DvV@+1ON zfuGxXg4k8DO-p573F@$PwK^6%qc6$Ol*>RS%d^KeDH`{ncFrpoa#ww_LfVm-dbo)! zN}KX_*Qg-eJhvCZzLrP|Y|~@X&Xq*6>Jb)Mo#-kBQwo)OzFd&Ne^R?l_YJ8F!jZ!` z7u8U~7G8(S~@urM;F z7b4B;``hMIlP^ua4Uc16d>O9n8Jv5w0y1}`4c~8jHO&SJHBd24L8k6Hn4Rr{AV|=S3HYCloaak< z`wC}VdCjdWA7_6SXq0pqgE?Y@A$+F?N4>(LU#-ufDpwli9}@v=&6tBABSl$mx6eSm zYym_5K>|URD$7U9KPr9aJq8;WH-ac_UusZI!9EqfaS+c$7YR^V5$QyFWeg$jR{B*H z4a?hwrRGJqS|j>0NanjXQn4K*Pu6f{_|1i_xjrH?!!ws9Lj9w`_=A z@pXIADP9D)JMFL(*+HgIoweJ3Hw*{pgB4)VKkK zdwNC9X6lE|b^zGsSGab(>>#KT*`tn^kqRQ~OSE#1W7Bc^u#Qo{gLZI!WnNyALdg9t z=FQ>IVr*mnYCcH#iPx>m$foh}*%2;;9_(sg*SPIRPiq)yx{(?5Y%xorkii72G zv$3bKYY4;r{q~+Yw0drlXJiJaPo;(TrJ7Pe-(pJ?vLR0#;$v0IykGro{+7<-2}dv8m)YC4 zsesa{czQQjDu9Ldmh99J%9}1_5ulTe#mTnV;5*2{f=w9Wn*A+_xGPUfk`r4GB;`aEQkpd)ZSj8EYN`#wd6z05IlD;7Z|)jhM^WA ztus>Vv$o>r%7U#>)(htR(8rRRcRmV^{mk*()>Zd;3{J*--*OC~DdMH*YW91nUu$@P zY3I@%DnXG!TGKa7Q{{)wyDpS`Z@6vP-JITVZ3N>4f7*HIjIf4zi!W0YT*=5h%tP6G zevw9YYww^pMsHrTRb!24C}pXeA&L8W{u3Av1j!`P!q8dIANx%jT=QRzea8yLL-H7O zg)YnEQE+IX6Mv1Rr)9RV=|VQvMQ)BwUXCSh{`?g`#N!jE`E{jFp(jq8Z$-5dcG%X>nL1+YPd`8n>(p}-c@!<}9T(=L#1zT=fIv`13~G>80;F0BH6%20Ep=KO z0GZ3ZQBrTNe&fA}fKA)muLqLW{dQM!iR-v7NV5DEzKtTAdi(B*e^7KV$q>Wpkf7E| zb50UPwrE`>jhn@}gT7YNGlI_}pRK~_pY0h14X1m5V~>LQq1Za8oiPYIDa-f;sd#Y zcDUVzqhptwmjsumY>2I*T{fjxgzSjoa(m+-%2-VIR*7s=SYwXYpqp_z#WxF#s#Rd< zcmwlq{S(??Ak?uDAm$*K*I~PSOeW-Zb-SpbcjKMsE~&Ebf96|>O94G0T`GR?Co%9X zoT16tY0BM7k%kE`yzlA7YUZW8;uPL99k*HO?e?$6l$-oT9@^m_*(*^F_^g*M=v=>eI2o^n9%Pr5?lmlmp>E{s5Nj~x!};_dDqpH0koFDG0kXL zOWPnD#(!R|Bc>!zdfifZ0}bhnRv_su>9P?TJUn@xx&A&>MiT@u~uqLW{da5j3+G9YU>3JeCn1OS>p0UCopmL8 z3)Va5{Yq;o;M3uCTO0t}RY&%wMoh~Sh?-)n+8XMApiyATWal=`dP8w(gb=MsFVnoT zyPj>(f0(eoiiNac<1>?3RvTWUwe8gK{6LVn$3CVkXcye|KCU}O{9@BW9FhXOr@k92 z$DPX>kV3QT=cdV|v-k;`e6-VCJzeysOfh3f5$LtUOm+$KsZ4Lu_Fgr*(a(bkX&MW& z3X`J>3-`@I8^j(6nA*G)9+5S!viDxTQ!GibBAY}ZA^OYq_C2zqW>#B`MNA`9hJs>6 zU#L0`aR$>~az_kgNyiXVAFZ8m=*&88qt1<*S&_>P2MZ-82E|DJjZ|l5+vKpI>~DZ=Kxi@a-b-h5%ME5J4XTS`&6 zZoq&RFO}Z-dwWjt-9z>F7N3>6E$oEZazGU>9TTV+`7({1d45!fbtSnpsc-`1EC1JqGzR>|7byEk!PP2vt36DJ<{bj?GRJu-Ds4qfdx1-m^^NoE`-XN2CT6~CW{)68e>}wpg-DpXx=y;3)#Prr zT?F!FlC3wq&qTT@3`8Rb*LA=^E4-!hi~CT z-&zk1$K0(dGS9I03{T=eGr=1MEJS;SNgMh)qtDWPFfIo|U5w&fjHgyMTYI*0Nyn<)KQ&tm=LitCT53i%K7fgfu<3Wf@sP2)f1t* zMJYz^w2-9yd&E#<*)YPk4EL-j=I2 zp{YK3I)Bny-&{u7csL1VgBG)wR{T;j>y`KvU}i=5tm*Iwk>8Vs|k+7eXO0ndvY&uPPR?yvQV4#3s%v-inRcYoC_suE5G3pt*+;hn$H zUP&!JAzC@W8O-vFiXzLSiHW3@U7<~Gdgub%`9&4qzrIwxBv2PSJ4#?u0{uE{apj@^ zwyKYp7pg^U6s;-fMC;QXaLcvNuN{V!VA$VW)3C7H&`%$o-Qa4SnWgNZG4^B#^g0ut zjn39cPK=@ctIinZ5ArI+us~YqRc}Z!Az|An>^FQ%xd;7#SBo)ivT$l~WqmCManNy& zX!1q)K2z9gBHGiqbT7K^UU)55pY62%CMtnMS~}=~&pi<2&`+t-D*n-#X1^L0nkQw! zb=}{k;epXO=~*xa0J<2L;R#e!Vf_5JeritDJ6o3mvOmV@qkm+B$RL*Y(Z+oG&ktt0 z!_{P!Yjgjmtqh!X+v1vsVJO?@%x~+zt_O8)!%dXRBz58{{hr&O1_%#~T7aO2s(yX8a?l*)v6m#lqT zDX6HNHn|CZ(<7;KDvZ5H5jTh#YJi3sGuS)bd?jf66en(W8*X(PcwqNqP^(eFCnh*6 zTPHBZ-E|Qrpidq*m@tD~HB2F8`%H3BJbFCsI-{NhaRA*g6YSdgN)|x-^{*HH5P+?C zXp^t?t{mAd&k{X0TNMs_H#56kT>DZ#d#!^qWye=gyiIiR@haS)Jc=Ys#TFSR^5OQGeh)Gwp3p0MdYBY7OnJZB0jKGQeSC zNcN<0+8LknO^1iTe#OM*nFr4bb`@uxjKvZm|JCkK%VZ7$6i>!k;5rTAu5d?%tWw6g zt=b*h-Jd>Ijf09>^zqdp15Zd-73lirKx>XCbE{klcSS4ZxEBN8*+EP7Xz5`_o~eRT z)AET}A0FWCGV}k10K~FZJ_Q_g$1yj0=ygBu&-E{Ra{O+|K_d|j^yd7TjDFJYZ+ZGBG0$k9r!7sDI7{D8-G?mk-p+JcU(&G z!QapOtm(dwXu}N}8*Y{FzXUM-rn)=fsJwB2=TzUyXh3n%mz(fN+kMD+E(Qn=vw@_b zXUSDXb-Ch|af_yA;SXyiT;Uchm29$HX|4?HE?iDGljz24%o1`JV+~l9myD4}yx+nd z3^ zuvtE%$N_pOfkL z=U^?Ts`-NT6!z?2f>=qXit4W0OMHwt*u>A-_zk#3%QUpP9B zBT#hpp_x_2jrPJ%Ivy?Vj&@(IL-Bd{tf1qKqMf7lFrp{%Jwb`WtE+t|Ig?=_Ia$M_v!=(6YVI{W z?lmyvMz!}3U(ZU12zQTf2GZc!o@_f~#$m^Qs6{*?l}_b&u{r5$SpyXz%DuVOtz1u%iCx0XpHy*s>u=Yz`Y6ztlGP zP#8gf893Kf%1AwWn}P%>vHCu zf@Snh=Wv6Gv{AYLHTxA6XNW|G2x z!x&&kMEPoT@6`rN#ph?aBoag)jEutJ!t;w(!SOHfcwJSjB!YlIEXNbE`;bA0>S0?w zmkKe;k~(&RCoiGD&g>b>y(^pHzu03^`gwVRM(iSMDcq&>pS!aOSh?_U^TZM)bYX_9 z`gI(lzb)6N*|GVE!V2F$a&T6yCrUlRE!W2jPl_MF2r(QCGZ@6m2$wA;Z}@KiG||L5 z%-EXa@g2MvZ5HJiZdOs%&h-UJylPb|zsK({o#+u7W(qbx|D=>b9xu$p;Wal;s)DK1 zi;ir~>SVR`rtMQ8_t*}^^4_Er)l$#wv?)5-up0B+2|^fO+AEt1Xy?qV<@T1X=w{zz z!G|K`@y($20XwMgiMTG{06`lW;-NzRlTDCNpm0 zYznetu>CM{(X4iP63P%pvt??2qFrEsXCB6xzDvohwz_BMMV@mMw+LGa&U5})TF}quF=FDk_9~}1H!*++63B)oqR6uKBMi^jtx;&0q5a!%L z)9^DTb;1vsL&x<&$PVTpN%3d5SJEldB#gCP80E0I$Lq3$t1l%fxT~ZboJi5zGZUeG|2~}-vVCAX*hvN3qS~h zMehJS4r3iR-s>y6={U6H#IM{Nr`onn?#G4`FVHx@ib%H?`4M6CT8L&(tUjK*zC9s^ zwL9Uwu6>!$@Z$YnKjs^P`2g;4vWiSmTX*Efw`#Mx=T;xLd#G(+eVQ)`dwpR`U1scG zw(e)=^Qjr@s>FmuLGt0WG$?y~_#a_58QE>5?L~HYMVAn#ql2w9xm=2gi0BT6MQ|yI zgEfP3OaJw>a0~Xs9(?euGxeL>h57pS4#)LVWd6DhtC?7aX_j;;joJpwIz}gf5`+;> z#v?nL4Iu}1VYv+PFA(Z(l)#gp+mdqM$bJZa{2}YQfjOR&ju{}8v_6cVtk+#RUx zmRN|<8#@_jD9!>gkYu-1!;2iXH^TJ)AW=cFD%=0_=v)A4&~UBK=7x*KzTxWD`<96@ zli-t<++b7ad?)edwFZ{6HJd224P7Ke6VDVK38^B%b87=}>u!J2pT-!Vm7eR~$y?8V z_`9Z)I2dn48VUM2G>0K(#3V10vBUt*Bdqq1B{I_I-u_AB1y?5c_CW{t@nBqE1gzfD ze0LeE^VaQRSDFJER#(hs3AZY~kAy@&IX8Z}cb~xfP{r!fd1034;B=DrxTtuRo#V7G zjn95x7Axhl{`TbD`-%yV^44PK+RUCCsZ@zrT#+WE;bNsttbk0i&TFH)(9t3QK6?)d zNyT_)V}E)wO!J~!<5-qYl7r1*!PR|ccJ+n`PWd^hz4F8oPJJdnfu!98X-05cRc5OB&^lXja+EC#W7c^H>wi%$U2Lz zfGaZBsW6t2p|r&a2}u_N4sUdBExCckdLM^Duadl9F;zUS>PtI6TDm>oufDzF=f9jA z@xAtDc0O{6KFUF>@+~x*i6rP!>Rm{)AZS)g@z^hr*Z}WrE^!Je+VbAd>%U!sT3{Z%lE!-mbJ#Mc^u55O4I@4XN(QPDEuWK0M`aec5DA4mo z$*M35&fy{omtLyG4rY@Rd1iWTd^X4$DG^)I$k@xZ<;yjFBoCC78yy1+T7-n_86kmYk+H5-72Z}ir-B<=&(2iZeqiNL;rD)B-+blaxpsISMKVzDcrX(p0r{mq0s9yb;o}a5Mf_L1wG4rdzcyi#FUt{Vlsj=)l?Y4FH=DHDf zP;%Ryy+Eve8zg(|wY;U}3^|T$WaW0Qb28ne!t1%c)P$e%U#2WvUOAt7?(5wCZn?c^ zEVr&>xgDN9GD6~jZHAIx>~%KYQmv<+abt;!YI~hWiF#iL6n8IqyPcOe8{baru2Ftr zk9>%PRF-Gno4w<{v*T%_I|pqjy;)EDetXP!AmDskKL=fy7@yO+UGiY%U#K&@zVba+ zFkTBKPP^`Hjl*nkg8x23M4YbipHT-|ms@E~W{31AA!`;$g^-(tQm9YFQSjG6Iin?2 z%38!ok&sj~HjmF0NCs78+0aP(mG}$257cVR^NOVjYMtk2N7Jsh<`cFWwhEY%krK-| z?mJkPacaxZtujhUMZfz)LTco^nxWoroJr3)yz3w%;pxR8TeZ8rr-(iZHaB0UrnsK} z(D`plC4O()8zIZ$h(-^!voco&S#RvxOkN$xeCiHTm+H(&VidL3Amg3Xg}sX0TXnfR zlYFtaGcA)lR-z>?MH~_NjcK2M5gj(e90RG4y-K$Hvjz%^*3fxtUnY{iG_}_r(-o!b zUv5Gcu2+j^ttB~-p^?EMHJD*0AQAx&!@c%%qqMl{<;rs$aM?NQ-0&|r z^yG-|#-`>TOoEvs(quYV2xGbcO!o$ok1^^S(=JtMFYI!>*s-4A7L=b%9A{sC*66Ox zW|-@DL_$J}h0j!!o-U$I+_pp|-3*r#q+PPfq1(jt0Sp>z@JdL(?s)=kM?&I)qbhbY zsEo$oI^O;M%tof*sgWPG(8yy3o`h7DP;`+jB)4`^su^%c&`3>>na817dn>v%55O;* zAk{hAYTt;`T*c(VtOD>qNF4RQ$pRvWKg2k=Qsl1y34~D5uTSj#CsNe0LX)^6~hn zT=`cFp75@pEvn27)RKMTcgrvQhs+-PZZ)uUZe}|)=6`VEXYMy5$dAzdJCNd7sGqZC3$#y8`^$&>> zX274XAfxfY6wHQgOk7}rA^PRHOC4YzKlQ+8#C-z5)t@nYy<%Y5naWm{vZZHI>g3Qe z>k5bTdXt?40?j11`ipsUI5Rj;AW0fJXTJ`)9Epjk9Eqt6hm27MEw93+gbKb&7P|dV zO`fTbhiJmtCw09VE}GH)y=XpY9lCHkUfTUiLPL3@BC?H6q4pHlKQT)qQbTx>2tw|u zftiT>3Ou0d>ntkj1*%m({tw9**xttKvX9+|R-f^M8zU{)=1NeEviRM%`i$A*vJjiu z+cOg2_t=t1H9u;(-OfHWy}2|XqVfGy`d@BaI z{-KzM;&=KC>1kvI3i#(A@;_$@h~4oV(&z9yMnXb*E&hk71tTGMzrK>RQ)@v5_Dg`ufZviPSX%1&>B?v&`<+Pgu47RqDZjZR`I_<_;2tLBUS2mlH#ZK3hD8pBMcE7? zE{0~O^GhGg!Gvj6^}u3o3-OWINo~ovJ7G6tQL~=Py<5wqr8Yeys}YI+g8;c#tgeXb zUFwko4WGSlKzfNpy*97Qo4+@=pKTIYXcDL?D^sp1^Vtl{k`}7^?@>F3bN>xf-KNc6W!Fa|*OeI{8D1d27rki`TN*e*RIUS}^Wt z>*C43`W0|&crRQ2;N$}5fnJSZtY*Hmv*>YZ@rpOi^jnSH&?Ez`Nsk&Cqqc2qsEq7n z9W}3cU6SF1Ca)LM)`4HFv`n%^;A|FMpj!&tG!93%W<9r6V%3+f#Et-k-DAJlx8=uG z;>9QCP1%malZ{T+e>qcmG*+aJxzgR*Hdn1C3s^hClLQcP$w;BT}X=w$Mm+Z%xTLvOmRww&?h!p7Y38yLZ8p60diT$X}+62y(V7n-P9fWSb zuNGAtMPY1Y1hqh@?Y4Et4>rUHmAvAxK4SaF-e`R*&4b!1nD?5w#xnY)1J3l`h3sIPwc+dzEWS7j zpCpA>hxfXjg9Mfc7U}J{vYc{iRlRkB0q2_D+u4_$JU)TN%|?PV*9Qh0T#pb?;_6x| zxR(%w@ZAY~Erj>_l+(5>%k2Wzw;o5_a2x8t`|VE7WmL9^*`5iRvdYn)h6SkKkrTb@ zC{e<}2X`uYajZXf%>awV6L8@F&K42Oc64^kl584>&(<+&kxEXSUNrR=A8%F2h*)Ya zL@^?(bWS35g%-Qj6W?;W9c>hA)g~r^ryx}+7dZ&e2>K~vJrBAp*cbG=GyWQ?OYyo`5ss3_VGD*ZV_mbtXwQTA6Jy zd#YnjpXy=ivEqzLKi5xNKz!y^ARGx%H3^Q-h8J#r*$?pTP@Q1iFOJy1Ki*-d!D8z} zu`XPAJvPKjY+b+6y*{us z4ptt$GOq2iidT{HUNXtFdy@^SK&SQgV*;W;ra`rP7vG99sA=_2eL5c|o@(-t1)X9{%$!Bf5wnAB<&)?;)41Iew<|Ie(j}@j>7L}M2>34Yp7#VrO%BV9;4+se zC*-d>V?i1`S5fWcR+T1?QslWOHougZmSvWeD5_m)mJlXd-A=>|o{Em=1!5f%&^0(| z)={ecFlCkmi#Rr5=-FmuEfI(v0*~W;Be!E+Ut*dVDye-ak;j?f!D0SDZ;<^^LV8pW zNIV_Hl>lG9Qk2mMEB?sC_8C6sNTYm0GtC}y6;_`h@2RC4v)A(F4 zPW?Se;W38>;0=uSn}ZFL!x9Y#?Zd&wNyU#L1Qh%gP}dQu;N!TUB1yM0-5Q6D+5Qe1 z%yrtV6VBi#-%DO*@MgdtJ}mnQoGZ@C+ISC+g4j;cppHxfp$uJHNAFU6VvEU%g|G~`=rPM9as(*y&Vi++ENO&a$J#4ne8d41GsHj$DnvW2UN78N5gd-+ue zbL^3Y^v#JpEUIKDP3&eT-Ly=1aaXUjl&EtFRZJc1tN2K1u2#mnoRw%@>9Ag-)=0^! z+W~N>65{9(14=pB8giZ^)5VrmWE_IW0=A3Gbs^c^#Vt`j+iVVz|Ijzq+H9vi(@cX{ ztCpS}yyeiexEf={&oHFP*s$ULJ^k^Kl!tq)<`fd@4%-P50%>_(L#KNl-HA0 z+K)U(%AGBC1tD&nBE}b)okXFDO{ao;`FI4k%v$`*My6GlKFvp~?*_?E$7T9yZvnei zcFPwG+Q@TzzTKup;19^gjeZf9?8zV1OQhs}<(rEu>1m#b8PvGM82ipddp2j($s}<= za&t*%5sNl4yZqID&r&dZ$kIRPlY!uZM4V!V=RAOXBMDv+Yi_)pKZBX}SJpVxY z2tL|0A5|)uTqY3>Bc7`?SFy)&P|RXYjE>b*-u)r>HuHR;{w-!%X?srG^VwQI(?l6{kK>ZP3$Q+O^AzCBPCPjUZzLBo znE2u`)HHD*UmCZw7kyzQ*6Z02Ys%P(mD4$gf%NFJ?q2O$1WJiaC|+;>p852;j61iM zlkLT-Iy~^NZ~IxfM*pu*@c-Gp70?~OpVh5i_Hmkni;GXq(xT2RW~4!)<{?s{G;p;4 z(a1*&%#e&O=6BDP?&wtCztL$ptpP$Y?~5R#R;`oo;>|&B6AIGAoeLlS-nTR$yHrq- zM$7&*90iEg<);`iBO50B0<#gZ2#hRw+Ht=|j%Znx649H4#TEw|k0%e1VAOZd>3!Vl zejvB4`bl%()kofs#Vby?7+ermibluP_O1SSq|Y)@z{58e{e&3&N|C}p(@DbMq^m|q zr%1!*rF=@oA!+@~gIsRp-0*#=noE}H&nt;7RJvpCJmu{C^EuyDA`RTMlO;U@Sx&xz zB_9Y0YaN3V^==&$s(GSm0g;w_s6MDwlHhxk?rGzv~s}vT<7f6k#!$Pyr zN@9W*!bAxCi3kc~J7>dQ@tYjR?~|?3WkJ4E0WUGX)4>Y)bLE|{YM=t*$mzMfrltuFev!U8<`6GHijVw!)&De8So2^o7;`?4a>x1fhe|5@$d?j?;mO z+|(~{x8RSL$wDewZ$|2DD|z_bSftW43ntQgQ7Mp-%)bGeR>fi5vKWcaGcgsPA1L{*R_Z=pk5kU7ucPZ%>U!a{-r#U1D<447=)Na`FF~eFg%5S|*TatjGp@5B*BEU9R7%jwSX9z3V@IDVlbo(R76 zyC787atv<4HhaNH#YoC#_sodKJtXshyG4=NeQ2+5mHYH~UDdSa4Z9qn+1fMHggBux z&!4p0^5;KyG1kpj&u)SggqX~p7pBOBDZofDcI!9gq%0%HjHdhgeLiIj3mxXJnw08W zeb7V9`oF48Y?RqTrdz!pH?q`4(q-7ppWNCH%McCQnW-$OeuVUSO9kY~IDfG!Re#<5 zqMw1f_kuLVU@~AaAi^BW9qDtZSr**|AixJoFX?vpAervHm3h&^3`oB^?tJNcz5Fb( zn6@>Cn9<%fd{|L>w+|9iyYPe@eGpX#*UuC99Objq6NG-bPg zb=>|e%QL1(JTo?C4}-(3v|N*s*83bU`NuDj+Q%o^?< zncUo8ASQ_u0kymrgVYxoJ!9Xz6Bb^9t(SE8pJudq-Hr zd)39HpZH#qG+Nt}d7HqNeHeVO*svOZ!MDRQf`*9}zVD7tC4b-5 z_TrzMiiB-$uVoOX!cH@)n``I2ZW?b5=6-(|9`WZqJ#nxc%e9NBQvOavW;pF$ILz&U=hg#^G!(p`jrmEV7o+YyB(~ zLIp*<)@QL+jLhLYI0}u5p*yCiKFkxmIFcbL?0e#|y;&1%AxpAe8?sQp`nY6#PUF&O zpiPwjYNxy5l0+@>M3d!Dv=?^d^nBza8NQGGL5%1B*hcZV`7b0aukwwq0Er}f<#pt=s&-;&I!&RFpNhjn=13e}f^lf1lE%(44X zb1U%a%egOgr+NQsTe5Cd!kcfqC)X)0x9fUW|Ky_Er=lN^XUfL!o>g79(p~@AV&=?R~j!`T6hP`EI3K;1p0={86)cK~BzX=kN3X zf8?K(wPoXyS8o@W$5vFox|;I$(pzi0s`OQXOUiElVXy!Acx4*r?Z$TYbN>GWtNM@K zJIlPYRkyg-+HUWTOwXxzj%?fcDqiMhz>ljx949-=-i-Kh_1KBUKX&esw4a``^RJ>* zXwhtT%ei{n#FzEH|C;yZ>+$!u_x#*+`=L8{b9SH^9&27u3G_Gxqxe`L2UJtdxghk z&-wzDFvLvW{chK5u3{n6GSKKy!P&C6w^IFpbD0bcp^A{{2lcLh_DXj@ybtYvc^;(2 M)78&qol`;+0Fu7JivR!s diff --git a/docs/output.md b/docs/output.md index 422a30854..fd09d59cf 100644 --- a/docs/output.md +++ b/docs/output.md @@ -14,6 +14,7 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - [FastQC](#fastqc) - Raw read QC - [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline + - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC @@ -29,16 +30,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d [FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). -![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) - -![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) - -![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) - -:::note -The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. -::: - ### MultiQC -[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). - -### MultiQC +[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/).### MultiQC
Output files @@ -43,9 +40,7 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d [MultiQC](http://multiqc.info) is a visualization tool that generates a single HTML report summarising all samples in your project. Most of the pipeline QC results are visualised in the report and further statistics are available in the report data directory. -Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQC. The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. For more information about how to use MultiQC reports, see . - -### Pipeline information +Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQC. The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. For more information about how to use MultiQC reports, see .### Pipeline information
Output files diff --git a/docs/usage.md b/docs/usage.md index 7e11c4391..e0aadb7d7 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -130,7 +130,7 @@ Several generic profiles are bundled with the pipeline which instruct the pipeli > [!IMPORTANT] > We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. -The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is suported, please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). +The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is supported, please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). Note that multiple profiles can be loaded, for example: `-profile test,docker` - the order of arguments is important! They are loaded in sequence, so later profiles can overwrite earlier profiles. diff --git a/nextflow.config b/nextflow.config index b85f84531..91cbc9579 100644 --- a/nextflow.config +++ b/nextflow.config @@ -283,3 +283,6 @@ validation { afterText = validation.help.afterText } } + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' diff --git a/ro-crate-metadata.json b/ro-crate-metadata.json index 7e69c2996..d300c3276 100644 --- a/ro-crate-metadata.json +++ b/ro-crate-metadata.json @@ -22,8 +22,8 @@ "@id": "./", "@type": "Dataset", "creativeWorkStatus": "InProgress", - "datePublished": "2024-12-12T11:24:08+00:00", - "description": "

\n \n \n \"nf-core/eager\"\n \n

\n\n[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml)\n[![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)\n[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)\n\n[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/)\n[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)\n[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)\n[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)\n[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/eager)\n\n[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23eager-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/eager)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/eager** is a bioinformatics pipeline that ...\n\n\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))\n2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/eager \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/eager/usage) and the [parameter documentation](https://nf-co.re/eager/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/eager/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/eager/output).\n\n## Credits\n\nnf-core/eager was originally written by The nf-core/eager community.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#eager` channel](https://nfcore.slack.com/channels/eager) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n", + "datePublished": "2025-01-14T08:43:48+00:00", + "description": "

\n \n \n \"nf-core/eager\"\n \n

[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml)\n[![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)\n[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)\n\n[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/)\n[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)\n[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)\n[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)\n[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/eager)\n\n[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23eager-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/eager)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/eager** is a bioinformatics pipeline that ...\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow.Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/eager \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/eager/usage) and the [parameter documentation](https://nf-co.re/eager/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/eager/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/eager/output).\n\n## Credits\n\nnf-core/eager was originally written by The nf-core/eager community.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#eager` channel](https://nfcore.slack.com/channels/eager) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n", "hasPart": [ { "@id": "main.nf" @@ -99,7 +99,7 @@ }, "mentions": [ { - "@id": "#34ae67b2-d8db-4c6c-b44e-279523e453e7" + "@id": "#50cd49be-32f5-4a58-bc06-c7cd2e7f81af" } ], "name": "nf-core/eager" @@ -131,7 +131,7 @@ } ], "dateCreated": "", - "dateModified": "2024-12-12T11:24:08Z", + "dateModified": "2025-01-14T08:43:48Z", "dct:conformsTo": "https://bioschemas.org/profiles/ComputationalWorkflow/1.0-RELEASE/", "keywords": [ "nf-core", @@ -168,11 +168,11 @@ "version": "!>=24.04.2" }, { - "@id": "#34ae67b2-d8db-4c6c-b44e-279523e453e7", + "@id": "#50cd49be-32f5-4a58-bc06-c7cd2e7f81af", "@type": "TestSuite", "instance": [ { - "@id": "#097abefd-a077-4f1a-875e-6b7e022e468e" + "@id": "#3d4c5eda-d55a-464d-8b9d-1d29a61b5449" } ], "mainEntity": { @@ -181,7 +181,7 @@ "name": "Test suite for nf-core/eager" }, { - "@id": "#097abefd-a077-4f1a-875e-6b7e022e468e", + "@id": "#3d4c5eda-d55a-464d-8b9d-1d29a61b5449", "@type": "TestInstance", "name": "GitHub Actions workflow for testing nf-core/eager", "resource": "repos/nf-core/eager/actions/workflows/ci.yml", diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index e8a324add..8a98c22a8 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -117,7 +117,7 @@ workflow PIPELINE_COMPLETION { main: summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") def multiqc_reports = multiqc_report.toList() - + // // Completion email and summary // From 8c66653bc996fed339b2a3c027207ddca4fff495 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Mon, 20 Jan 2025 14:35:18 +0000 Subject: [PATCH 32/36] Template update for nf-core/tools version 3.1.2 --- .github/workflows/download_pipeline.yml | 28 ++++++++++++++----------- .nf-core.yml | 2 +- CITATIONS.md | 4 +++- README.md | 10 ++++++--- nextflow.config | 2 +- ro-crate-metadata.json | 14 ++++++------- 6 files changed, 35 insertions(+), 25 deletions(-) diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 13b51e2c3..ab06316ea 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -34,6 +34,17 @@ jobs: REPO_LOWERCASE: ${{ steps.get_repo_properties.outputs.REPO_LOWERCASE }} REPOTITLE_LOWERCASE: ${{ steps.get_repo_properties.outputs.REPOTITLE_LOWERCASE }} REPO_BRANCH: ${{ steps.get_repo_properties.outputs.REPO_BRANCH }} + steps: + - name: Get the repository name and current branch + id: get_repo_properties + run: | + echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> "$GITHUB_OUTPUT" + echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> "$GITHUB_OUTPUT" + echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> "$GITHUB_OUTPUT" + + download: + runs-on: ubuntu-latest + needs: configure steps: - name: Install Nextflow uses: nf-core/setup-nextflow@v2 @@ -56,21 +67,10 @@ jobs: python -m pip install --upgrade pip pip install git+https://github.com/nf-core/tools.git@dev - - name: Get the repository name and current branch set as environment variable - id: get_repo_properties - run: | - echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> "$GITHUB_OUTPUT" - echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> "$GITHUB_OUTPUT" - echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> "$GITHUB_OUTPUT" - - name: Make a cache directory for the container images run: | mkdir -p ./singularity_container_images - download: - runs-on: ubuntu-latest - needs: configure - steps: - name: Download the pipeline env: NXF_SINGULARITY_CACHEDIR: ./singularity_container_images @@ -87,6 +87,9 @@ jobs: - name: Inspect download run: tree ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }} + - name: Inspect container images + run: tree ./singularity_container_images | tee ./container_initial + - name: Count the downloaded number of container images id: count_initial run: | @@ -123,7 +126,8 @@ jobs: final_count=${{ steps.count_afterwards.outputs.IMAGE_COUNT_AFTER }} difference=$((final_count - initial_count)) echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" - tree ./singularity_container_images + tree ./singularity_container_images > ./container_afterwards + diff ./container_initial ./container_afterwards exit 1 else echo "The pipeline can be downloaded successfully!" diff --git a/.nf-core.yml b/.nf-core.yml index 7ac5124dc..24ca81672 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -2,7 +2,7 @@ lint: nextflow_config: - config_defaults: - params.contamination_estimation_angsd_hapmap -nf_core_version: 3.1.2.dev0 +nf_core_version: 3.1.2 repository_type: pipeline template: author: The nf-core/eager community diff --git a/CITATIONS.md b/CITATIONS.md index 035b0d008..503be6627 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,7 +12,9 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) -> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online].- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. + +- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. diff --git a/README.md b/README.md index 776eeaf55..92b19a7ad 100644 --- a/README.md +++ b/README.md @@ -3,7 +3,9 @@ nf-core/eager -[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml) + + +[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml) [![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) @@ -32,7 +34,7 @@ ## Usage > [!NOTE] -> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow.Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. +> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. - + + + An extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file. diff --git a/nextflow.config b/nextflow.config index 91cbc9579..7e9b62b2a 100644 --- a/nextflow.config +++ b/nextflow.config @@ -249,7 +249,7 @@ manifest { // Nextflow plugins plugins { - id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet + id 'nf-schema@2.3.0' // Validation of pipeline parameters and creation of an input channel from a sample sheet } validation { diff --git a/ro-crate-metadata.json b/ro-crate-metadata.json index d300c3276..d1fc3a5db 100644 --- a/ro-crate-metadata.json +++ b/ro-crate-metadata.json @@ -22,8 +22,8 @@ "@id": "./", "@type": "Dataset", "creativeWorkStatus": "InProgress", - "datePublished": "2025-01-14T08:43:48+00:00", - "description": "

\n \n \n \"nf-core/eager\"\n \n

[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml)\n[![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)\n[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)\n\n[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/)\n[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)\n[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)\n[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)\n[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/eager)\n\n[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23eager-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/eager)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/eager** is a bioinformatics pipeline that ...\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow.Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/eager \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/eager/usage) and the [parameter documentation](https://nf-co.re/eager/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/eager/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/eager/output).\n\n## Credits\n\nnf-core/eager was originally written by The nf-core/eager community.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#eager` channel](https://nfcore.slack.com/channels/eager) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n", + "datePublished": "2025-01-20T14:35:02+00:00", + "description": "

\n \n \n \"nf-core/eager\"\n \n

\n\n[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml)\n[![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)\n[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)\n\n[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/)\n[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)\n[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)\n[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)\n[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/eager)\n\n[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23eager-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/eager)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/eager** is a bioinformatics pipeline that ...\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/eager \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/eager/usage) and the [parameter documentation](https://nf-co.re/eager/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/eager/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/eager/output).\n\n## Credits\n\nnf-core/eager was originally written by The nf-core/eager community.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#eager` channel](https://nfcore.slack.com/channels/eager) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n", "hasPart": [ { "@id": "main.nf" @@ -99,7 +99,7 @@ }, "mentions": [ { - "@id": "#50cd49be-32f5-4a58-bc06-c7cd2e7f81af" + "@id": "#8acdcbdc-49b4-47a6-a97f-37d8932a3501" } ], "name": "nf-core/eager" @@ -131,7 +131,7 @@ } ], "dateCreated": "", - "dateModified": "2025-01-14T08:43:48Z", + "dateModified": "2025-01-20T14:35:02Z", "dct:conformsTo": "https://bioschemas.org/profiles/ComputationalWorkflow/1.0-RELEASE/", "keywords": [ "nf-core", @@ -168,11 +168,11 @@ "version": "!>=24.04.2" }, { - "@id": "#50cd49be-32f5-4a58-bc06-c7cd2e7f81af", + "@id": "#8acdcbdc-49b4-47a6-a97f-37d8932a3501", "@type": "TestSuite", "instance": [ { - "@id": "#3d4c5eda-d55a-464d-8b9d-1d29a61b5449" + "@id": "#f2aebeaf-aa52-460c-b5ec-36f8f1c0eb7e" } ], "mainEntity": { @@ -181,7 +181,7 @@ "name": "Test suite for nf-core/eager" }, { - "@id": "#3d4c5eda-d55a-464d-8b9d-1d29a61b5449", + "@id": "#f2aebeaf-aa52-460c-b5ec-36f8f1c0eb7e", "@type": "TestInstance", "name": "GitHub Actions workflow for testing nf-core/eager", "resource": "repos/nf-core/eager/actions/workflows/ci.yml", From 1df63c8699bbf62afefaf1aa14908d0a4fe2c460 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 24 Jan 2025 10:16:39 +0100 Subject: [PATCH 33/36] Update .prettierignore --- .prettierignore | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.prettierignore b/.prettierignore index e67d050e3..7dc8ef0e9 100644 --- a/.prettierignore +++ b/.prettierignore @@ -12,4 +12,4 @@ testing* bin/ ro-crate-metadata.json test/ -dev_docs.md \ No newline at end of file +dev_docs.md From fb7c0c5dfed426499b350708021d358e760ffbde Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 24 Jan 2025 12:49:49 +0100 Subject: [PATCH 34/36] Temporarily deactivate latest-everything --- .github/workflows/ci.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 49a7e861d..b63419b78 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -28,7 +28,7 @@ jobs: matrix: NXF_VER: - "24.04.2" - - "latest-everything" + #- "latest-everything" profile: - "conda" - "docker" From 433b7ac1e9f4135c10c2a6a7b7fb613c74c735d5 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Tue, 28 Jan 2025 08:57:58 +0100 Subject: [PATCH 35/36] Apply suggestions from code review --- docs/output.md | 7 +++++-- 1 file changed, 5 insertions(+), 2 deletions(-) diff --git a/docs/output.md b/docs/output.md index 14722a77c..7181611fd 100644 --- a/docs/output.md +++ b/docs/output.md @@ -10,7 +10,8 @@ The directories listed below will be created in the results directory after the The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes data using the following steps: -- [FastQC](#fastqc) - Raw read QC- [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline +- [FastQC](#fastqc) - Raw read QC +- [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC @@ -28,7 +29,9 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d
-[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/).### MultiQC +[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). + +### MultiQC
Output files From 3a8f3037598c3328b1ce8e3842f3f56714a4d5fd Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Tue, 28 Jan 2025 08:58:15 +0100 Subject: [PATCH 36/36] Update docs/output.md --- docs/output.md | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/docs/output.md b/docs/output.md index 7181611fd..70aeb3790 100644 --- a/docs/output.md +++ b/docs/output.md @@ -45,7 +45,9 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d [MultiQC](http://multiqc.info) is a visualization tool that generates a single HTML report summarising all samples in your project. Most of the pipeline QC results are visualised in the report and further statistics are available in the report data directory. -Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQC. The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. For more information about how to use MultiQC reports, see .### Pipeline information +Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQC. The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. For more information about how to use MultiQC reports, see . + +### Pipeline information
Output files
diff --git a/docs/usage.md b/docs/usage.md index 945ffa9e3..5e5ae91b7 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -85,9 +85,9 @@ The above pipeline run specified with a params file in yaml format: nextflow run nf-core/eager -profile docker -params-file params.yaml ``` -with `params.yaml` containing: +with: -```yaml +```yaml title="params.yaml" input: './samplesheet.csv' outdir: './results/' genome: 'GRCh37' @@ -199,14 +199,6 @@ See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -## Azure Resource Requests - -To be used with the `azurebatch` profile by specifying the `-profile azurebatch`. -We recommend providing a compute `params.vm_type` of `Standard_D16_v3` VMs by default but these options can be changed if required. - -Note that the choice of VM size depends on your quota and the overall workload during the analysis. -For a thorough list, please refer the [Azure Sizes for virtual machines in Azure](https://docs.microsoft.com/en-us/azure/virtual-machines/sizes). - ## Running in the background Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. diff --git a/main.nf b/main.nf index 4c4aec4ff..4facc4faa 100644 --- a/main.nf +++ b/main.nf @@ -9,8 +9,6 @@ ---------------------------------------------------------------------------------------- */ -nextflow.enable.dsl = 2 - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS @@ -20,7 +18,6 @@ nextflow.enable.dsl = 2 include { EAGER } from './workflows/eager' include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_eager_pipeline' include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_eager_pipeline' - include { getGenomeAttribute } from './subworkflows/local/utils_nfcore_eager_pipeline' /* @@ -56,10 +53,8 @@ workflow NFCORE_EAGER { EAGER ( samplesheet ) - emit: multiqc_report = EAGER.out.multiqc_report // channel: /path/to/multiqc_report.html - } /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -70,27 +65,24 @@ workflow NFCORE_EAGER { workflow { main: - // // SUBWORKFLOW: Run initialisation tasks // PIPELINE_INITIALISATION ( params.version, - params.help, params.validate_params, params.monochrome_logs, args, params.outdir, params.input ) - + // // WORKFLOW: Run main workflow // NFCORE_EAGER ( PIPELINE_INITIALISATION.out.samplesheet ) - // // SUBWORKFLOW: Run completion tasks // diff --git a/modules.json b/modules.json index ff0462c3e..3d8d7b1a7 100644 --- a/modules.json +++ b/modules.json @@ -7,12 +7,12 @@ "nf-core": { "fastqc": { "branch": "master", - "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] } } @@ -21,17 +21,17 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "d20fb2a9cc3e2835e9d067d1046a63252eb17352", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "92de218a329bfc9a9033116eb5f65fd270e72ba3", + "git_sha": "2fdce49d30c0254f76bc0f13c55c17455c1251ab", "installed_by": ["subworkflows"] }, - "utils_nfvalidation_plugin": { + "utils_nfschema_plugin": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", "installed_by": ["subworkflows"] } } diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml index 1787b38a9..691d4c763 100644 --- a/modules/nf-core/fastqc/environment.yml +++ b/modules/nf-core/fastqc/environment.yml @@ -1,7 +1,5 @@ -name: fastqc channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d79f1c862..d8989f481 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -26,7 +26,10 @@ process FASTQC { def rename_to = old_new_pairs*.join(' ').join(' ') def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') - def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') + // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) + // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 + // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label + def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus // FastQC memory value allowed range (100 - 10000) def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index ee5507e06..4827da7af 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -16,35 +16,44 @@ tools: homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ licence: ["GPL-2.0-only"] + identifier: biotools:fastqc input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - html: - type: file - description: FastQC report - pattern: "*_{fastqc.html}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.html": + type: file + description: FastQC report + pattern: "*_{fastqc.html}" - zip: - type: file - description: FastQC report archive - pattern: "*_{fastqc.zip}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.zip": + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index 70edae4d9..e9d79a074 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -23,17 +23,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_single") } + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -54,16 +51,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,13 +78,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -109,13 +102,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -138,22 +129,20 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -173,21 +162,18 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } test("sarscov2 single-end [fastq] - stub") { - options "-stub" - + options "-stub" when { process { """ @@ -201,12 +187,123 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out.html.collect { file(it[1]).getName() } + - process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match("fastqc_stub") } + { assert process.success }, + { assert snapshot(process.out).match() } ) } } + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 86f7c3115..d5db3092f 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,88 +1,392 @@ { - "fastqc_versions_interleaved": { + "sarscov2 custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:07.293713" + "timestamp": "2024-07-22T11:02:16.374038" }, - "fastqc_stub": { + "sarscov2 single-end [fastq] - stub": { "content": [ - [ - "test.html", - "test.zip", - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:31:01.425198" + "timestamp": "2024-07-22T11:03:10.93942" }, - "fastqc_versions_multiple": { + "sarscov2 interleaved [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:55.797907" + "timestamp": "2024-07-22T11:01:42.355718" }, - "fastqc_versions_bam": { + "sarscov2 paired-end [bam]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:26.795862" + "timestamp": "2024-07-22T11:01:53.276274" }, - "fastqc_versions_single": { + "sarscov2 multiple [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:27.043675" + "timestamp": "2024-07-22T11:02:05.527626" }, - "fastqc_versions_paired": { + "sarscov2 paired-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:47.584191" + "timestamp": "2024-07-22T11:03:02.304411" }, - "fastqc_versions_custom_prefix": { + "sarscov2 single-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:41:14.576531" + "timestamp": "2024-07-22T11:02:53.550742" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index ca39fb67e..f1cd99b07 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -1,7 +1,5 @@ -name: multiqc channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::multiqc=1.21 + - bioconda::multiqc=1.24.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 47ac352f9..b9ccebdbb 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,14 +3,16 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.21--pyhdfd78af_0' : - 'biocontainers/multiqc:1.21--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -23,16 +25,22 @@ process MULTIQC { script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' - def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ $args \\ $config \\ + $prefix \\ $extra_config \\ $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index 45a9bc35e..b16c18792 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,5 +1,6 @@ name: multiqc -description: Aggregate results from bioinformatics analyses across many samples into a single report +description: Aggregate results from bioinformatics analyses across many samples into + a single report keywords: - QC - bioinformatics tools @@ -12,40 +13,59 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] + identifier: biotools:multiqc input: - - multiqc_files: - type: file - description: | - List of reports / files recognised by MultiQC, for example the html and zip output of FastQC - - multiqc_config: - type: file - description: Optional config yml for MultiQC - pattern: "*.{yml,yaml}" - - extra_multiqc_config: - type: file - description: Second optional config yml for MultiQC. Will override common sections in multiqc_config. - pattern: "*.{yml,yaml}" - - multiqc_logo: - type: file - description: Optional logo file for MultiQC - pattern: "*.{png}" + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: - type: file - description: MultiQC report file - pattern: "multiqc_report.html" + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" - data: - type: directory - description: MultiQC data dir - pattern: "multiqc_data" + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" - plots: - type: file - description: Plots created by MultiQC - pattern: "*_data" + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@abhi18av" - "@bunop" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index f1c4242ef..33316a7dd 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -8,6 +8,8 @@ nextflow_process { tag "modules_nfcore" tag "multiqc" + config "./nextflow.config" + test("sarscov2 single-end [fastqc]") { when { @@ -17,6 +19,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -41,6 +45,8 @@ nextflow_process { input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -66,6 +72,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index bfebd8029..b779e4692 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:48:55.657331" + "timestamp": "2024-07-10T12:41:34.562023" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:49:49.071937" + "timestamp": "2024-07-10T11:27:11.933869532" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:49:25.457567" + "timestamp": "2024-07-10T11:26:56.709849369" } -} \ No newline at end of file +} diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 000000000..c537a6a3e --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/nextflow.config b/nextflow.config index 9ab23b082..847c09fc0 100644 --- a/nextflow.config +++ b/nextflow.config @@ -16,7 +16,6 @@ params { genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false - // MultiQC options multiqc_config = null multiqc_title = null @@ -33,48 +32,26 @@ params { monochrome_logs = false hook_url = null help = false + help_full = false + show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' - // Config options config_profile_name = null config_profile_description = null + custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null - - // Max resource options - // Defaults only, expecting to be overwritten - max_memory = '128.GB' - max_cpus = 16 - max_time = '240.h' - // Schema validation default options - validationFailUnrecognisedParams = false - validationLenientMode = false - validationSchemaIgnoreParams = 'genomes,igenomes_base' - validationShowHiddenParams = false - validate_params = true - + validate_params = true + } // Load base.config by default for all pipelines includeConfig 'conf/base.config' -// Load nf-core custom profiles from different Institutions -try { - includeConfig "${params.custom_config_base}/nfcore_custom.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config") -} - -// Load nf-core/eager custom profiles from different institutions. -try { - includeConfig "${params.custom_config_base}/pipeline/eager.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config/eager profiles: ${params.custom_config_base}/pipeline/eager.config") -} profiles { debug { dumpHashes = true @@ -89,7 +66,7 @@ profiles { podman.enabled = false shifter.enabled = false charliecloud.enabled = false - conda.channels = ['conda-forge', 'bioconda', 'defaults'] + conda.channels = ['conda-forge', 'bioconda'] apptainer.enabled = false } mamba { @@ -178,25 +155,23 @@ profiles { test_full { includeConfig 'conf/test_full.config' } } -// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile -// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled -// Set to your registry if you have a mirror of containers -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' +// Load nf-core custom profiles from different Institutions +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" -// Nextflow plugins -plugins { - id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet -} +// Load nf-core/eager custom profiles from different institutions. +// TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs +// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/eager.config" : "/dev/null" +// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' +charliecloud.registry = 'quay.io' // Load igenomes.config if required -if (!params.igenomes_ignore) { - includeConfig 'conf/igenomes.config' -} else { - params.genomes = [:] -} +includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -208,8 +183,15 @@ env { JULIA_DEPOT_PATH = "/usr/local/share/julia" } -// Capture exit codes from upstream processes when piping -process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Set bash options +process.shell = """\ +bash + +set -e # Exit if a tool returns a non-zero status/exit code +set -u # Treat unset variables and parameters as an error +set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute +set -C # No clobber - prevent output redirection from overwriting files. +""" // Disable process selector warnings by default. Use debug profile to enable warnings. nextflow.enable.configProcessNamesValidation = false @@ -238,43 +220,47 @@ manifest { homePage = 'https://github.com/nf-core/eager' description = """A fully reproducible and state-of-the-art ancient DNA analysis pipeline""" mainScript = 'main.nf' - nextflowVersion = '!>=23.04.0' + nextflowVersion = '!>=24.04.2' version = '3.0.0dev' doi = '' } -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' +// Nextflow plugins +plugins { + id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} + +validation { + defaultIgnoreParams = ["genomes"] + help { + enabled = true + command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" + showHiddenParameter = "show_hidden" + beforeText = """ +-\033[2m----------------------------------------------------\033[0m- + \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m +\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m +\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m +\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m + \033[0;32m`._,._,\'\033[0m +\033[0;35m ${manifest.name} ${manifest.version}\033[0m +-\033[2m----------------------------------------------------\033[0m- +""" + afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} +* The nf-core framework + https://doi.org/10.1038/s41587-020-0439-x -// Function to ensure that resource requirements don't go beyond -// a maximum limit -def check_max(obj, type) { - if (type == 'memory') { - try { - if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1) - return params.max_memory as nextflow.util.MemoryUnit - else - return obj - } catch (all) { - println " ### ERROR ### Max memory '${params.max_memory}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'time') { - try { - if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1) - return params.max_time as nextflow.util.Duration - else - return obj - } catch (all) { - println " ### ERROR ### Max time '${params.max_time}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'cpus') { - try { - return Math.min( obj, params.max_cpus as int ) - } catch (all) { - println " ### ERROR ### Max cpus '${params.max_cpus}' is not valid! Using default value: $obj" - return obj - } +* Software dependencies + https://github.com/${manifest.name}/blob/master/CITATIONS.md +""" + } + summary { + beforeText = validation.help.beforeText + afterText = validation.help.afterText } } + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' + diff --git a/nextflow_schema.json b/nextflow_schema.json index 9496d218c..2a53530ee 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/eager/master/nextflow_schema.json", "title": "nf-core/eager pipeline parameters", "description": "A fully reproducible and state-of-the-art ancient DNA analysis pipeline", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -71,6 +71,14 @@ "fa_icon": "fas fa-ban", "hidden": true, "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`." + }, + "igenomes_base": { + "type": "string", + "format": "directory-path", + "description": "The base path to the igenomes reference files", + "fa_icon": "fas fa-ban", + "hidden": true, + "default": "s3://ngi-igenomes/igenomes/" } } }, @@ -122,41 +130,6 @@ } } }, - "max_job_request_options": { - "title": "Max job request options", - "type": "object", - "fa_icon": "fab fa-acquisitions-incorporated", - "description": "Set the top limit for requested resources for any single job.", - "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.", - "properties": { - "max_cpus": { - "type": "integer", - "description": "Maximum number of CPUs that can be requested for any single job.", - "default": 16, - "fa_icon": "fas fa-microchip", - "hidden": true, - "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`" - }, - "max_memory": { - "type": "string", - "description": "Maximum amount of memory that can be requested for any single job.", - "default": "128.GB", - "fa_icon": "fas fa-memory", - "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", - "hidden": true, - "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`" - }, - "max_time": { - "type": "string", - "description": "Maximum amount of time that can be requested for any single job.", - "default": "240.h", - "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", - "hidden": true, - "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" - } - } - }, "generic_options": { "title": "Generic options", "type": "object", @@ -164,12 +137,6 @@ "description": "Less common options for the pipeline, typically set in a config file.", "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", "properties": { - "help": { - "type": "boolean", - "description": "Display help text.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, "version": { "type": "boolean", "description": "Display version and exit.", @@ -245,27 +212,6 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "validationShowHiddenParams": { - "type": "boolean", - "fa_icon": "far fa-eye-slash", - "description": "Show all params when using `--help`", - "hidden": true, - "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." - }, - "validationFailUnrecognisedParams": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters fails when an unrecognised parameter is found.", - "hidden": true, - "help_text": "By default, when an unrecognised parameter is found, it returns a warinig." - }, - "validationLenientMode": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters in lenient more.", - "hidden": true, - "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." - }, "pipelines_testdata_base_path": { "type": "string", "fa_icon": "far fa-check-circle", @@ -278,19 +224,16 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" - }, - { - "$ref": "#/definitions/reference_genome_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/institutional_config_options" + "$ref": "#/$defs/reference_genome_options" }, { - "$ref": "#/definitions/max_job_request_options" + "$ref": "#/$defs/institutional_config_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index d56d81fa8..b7b66db7a 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -8,17 +8,14 @@ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { UTILS_NFVALIDATION_PLUGIN } from '../../nf-core/utils_nfvalidation_plugin' -include { paramsSummaryMap } from 'plugin/nf-validation' -include { fromSamplesheet } from 'plugin/nf-validation' -include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' +include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { samplesheetToList } from 'plugin/nf-schema' include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' -include { dashedLine } from '../../nf-core/utils_nfcore_pipeline' -include { nfCoreLogo } from '../../nf-core/utils_nfcore_pipeline' include { imNotification } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' -include { workflowCitation } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* ======================================================================================== @@ -30,7 +27,6 @@ workflow PIPELINE_INITIALISATION { take: version // boolean: Display version and exit - help // boolean: Display help text validate_params // boolean: Boolean whether to validate parameters against the schema at runtime monochrome_logs // boolean: Do not use coloured log outputs nextflow_cli_args // array: List of positional nextflow CLI args @@ -51,20 +47,16 @@ workflow PIPELINE_INITIALISATION { workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 ) + // // Validate parameters and generate parameter summary to stdout // - pre_help_text = nfCoreLogo(monochrome_logs) - post_help_text = '\n' + workflowCitation() + '\n' + dashedLine(monochrome_logs) - def String workflow_command = "nextflow run ${workflow.manifest.name} -profile --input samplesheet.csv --outdir " - UTILS_NFVALIDATION_PLUGIN ( - help, - workflow_command, - pre_help_text, - post_help_text, + UTILS_NFSCHEMA_PLUGIN ( + workflow, validate_params, - "nextflow_schema.json" + null ) + // // Check config provided to the pipeline @@ -80,8 +72,9 @@ workflow PIPELINE_INITIALISATION { // // Create channel from input file provided through params.input // + Channel - .fromSamplesheet("input") + .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) .map { meta, fastq_1, fastq_2 -> if (!fastq_2) { @@ -91,8 +84,8 @@ workflow PIPELINE_INITIALISATION { } } .groupTuple() - .map { - validateInputSamplesheet(it) + .map { samplesheet -> + validateInputSamplesheet(samplesheet) } .map { meta, fastqs -> @@ -117,13 +110,13 @@ workflow PIPELINE_COMPLETION { email // string: email address email_on_fail // string: email address sent on pipeline failure plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published monochrome_logs // boolean: Disable ANSI colour codes in log output hook_url // string: hook URL for notifications multiqc_report // string: Path to MultiQC report main: - summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") // @@ -131,11 +124,18 @@ workflow PIPELINE_COMPLETION { // workflow.onComplete { if (email || email_on_fail) { - completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs, multiqc_report.toList()) + completionEmail( + summary_params, + email, + email_on_fail, + plaintext_email, + outdir, + monochrome_logs, + multiqc_report.toList() + ) } completionSummary(monochrome_logs) - if (hook_url) { imNotification(summary_params, hook_url) } @@ -165,7 +165,7 @@ def validateInputSamplesheet(input) { def (metas, fastqs) = input[1..2] // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end - def endedness_ok = metas.collect{ it.single_end }.unique().size == 1 + def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 if (!endedness_ok) { error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") } @@ -197,7 +197,6 @@ def genomeExistsError() { error(error_string) } } - // // Generate methods description for MultiQC // @@ -239,8 +238,10 @@ def methodsDescriptionText(mqc_methods_yaml) { // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list def temp_doi_ref = "" - String[] manifest_doi = meta.manifest_map.doi.tokenize(",") - for (String doi_ref: manifest_doi) temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + def manifest_doi = meta.manifest_map.doi.tokenize(",") + manifest_doi.each { doi_ref -> + temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + } meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) } else meta["doi_text"] = "" meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " @@ -261,3 +262,4 @@ def methodsDescriptionText(mqc_methods_yaml) { return description_html.toString() } + diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index ac31f28f6..28e32b200 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -2,10 +2,6 @@ // Subworkflow with functionality that may be useful for any Nextflow pipeline // -import org.yaml.snakeyaml.Yaml -import groovy.json.JsonOutput -import nextflow.extension.FilesEx - /* ======================================================================================== SUBWORKFLOW DEFINITION @@ -58,7 +54,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Generate version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -79,10 +75,10 @@ def dumpParametersToJSON(outdir) { def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') def filename = "params_${timestamp}.json" def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = JsonOutput.toJson(params) - temp_pf.text = JsonOutput.prettyPrint(jsonStr) + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) - FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() } @@ -90,7 +86,7 @@ def dumpParametersToJSON(outdir) { // When running with -profile conda, warn if channels have not been set-up appropriately // def checkCondaChannels() { - Yaml parser = new Yaml() + def parser = new org.yaml.snakeyaml.Yaml() def channels = [] try { def config = parser.load("conda config --show channels".execute().text) @@ -102,14 +98,16 @@ def checkCondaChannels() { // Check that all channels are present // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def required_channels_in_order = ['conda-forge', 'bioconda'] def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) + + required_channels_in_order.eachWithIndex { channel, index -> + if (index < required_channels_in_order.size() - 1) { + channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index+1])) + } } if (channels_missing | channel_priority_violation) { diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config index d0a926bf6..a09572e5b 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -3,7 +3,7 @@ manifest { author = """nf-core""" homePage = 'https://127.0.0.1' description = """Dummy pipeline""" - nextflowVersion = '!>=23.04.0' + nextflowVersion = '!>=23.04.0' version = '9.9.9' doi = 'https://doi.org/10.5281/zenodo.5070524' } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index 14558c392..cbd8495bb 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -2,9 +2,6 @@ // Subworkflow with utility functions specific to the nf-core pipeline template // -import org.yaml.snakeyaml.Yaml -import nextflow.extension.FilesEx - /* ======================================================================================== SUBWORKFLOW DEFINITION @@ -34,7 +31,7 @@ workflow UTILS_NFCORE_PIPELINE { // Warn if a -profile or Nextflow config has not been provided to run the pipeline // def checkConfigProvided() { - valid_config = true + def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + @@ -66,11 +63,13 @@ def checkProfileProvided(nextflow_cli_args) { // def workflowCitation() { def temp_doi_ref = "" - String[] manifest_doi = workflow.manifest.doi.tokenize(",") + def manifest_doi = workflow.manifest.doi.tokenize(",") // Using a loop to handle multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list - for (String doi_ref: manifest_doi) temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + manifest_doi.each { doi_ref -> + temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + } return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + @@ -84,7 +83,7 @@ def workflowCitation() { // Generate workflow version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -102,8 +101,8 @@ def getWorkflowVersion() { // Get software versions for pipeline // def processVersionsFromYAML(yaml_file) { - Yaml yaml = new Yaml() - versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def yaml = new org.yaml.snakeyaml.Yaml() + def versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } return yaml.dumpAsMap(versions).trim() } @@ -124,7 +123,7 @@ def workflowVersionToYAML() { def softwareVersionsToYAML(ch_versions) { return ch_versions .unique() - .map { processVersionsFromYAML(it) } + .map { version -> processVersionsFromYAML(version) } .unique() .mix(Channel.of(workflowVersionToYAML())) } @@ -134,19 +133,19 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - for (group in summary_params.keySet()) { + summary_params.keySet().each { group -> def group_params = summary_params.get(group) // This gets the parameters of that particular group if (group_params) { summary_section += "

    $group

    \n" summary_section += "
    \n" - for (param in group_params.keySet()) { + group_params.keySet().sort().each { param -> summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" } summary_section += "
    \n" } } - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" as String yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" @@ -161,7 +160,7 @@ def paramsSummaryMultiqc(summary_params) { // nf-core logo // def nfCoreLogo(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map String.format( """\n ${dashedLine(monochrome_logs)} @@ -180,7 +179,7 @@ def nfCoreLogo(monochrome_logs=true) { // Return dashed line // def dashedLine(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map return "-${colors.dim}----------------------------------------------------${colors.reset}-" } @@ -188,7 +187,7 @@ def dashedLine(monochrome_logs=true) { // ANSII colours used for terminal logging // def logColours(monochrome_logs=true) { - Map colorcodes = [:] + def colorcodes = [:] as Map // Reset / Meta colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" @@ -287,7 +286,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi } def summary = [:] - for (group in summary_params.keySet()) { + summary_params.keySet().sort().each { group -> summary << summary_params[group] } @@ -344,10 +343,10 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def sendmail_html = sendmail_template.toString() // Send the HTML e-mail - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { throw new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } @@ -364,13 +363,13 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); output_tf.delete() } @@ -378,7 +377,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Print pipeline summary on completion // def completionSummary(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" @@ -395,7 +394,7 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - for (group in summary_params.keySet()) { + summary_params.keySet().sort().each { group -> summary << summary_params[group] } diff --git a/subworkflows/nf-core/utils_nfschema_plugin/main.nf b/subworkflows/nf-core/utils_nfschema_plugin/main.nf new file mode 100644 index 000000000..4994303ea --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/main.nf @@ -0,0 +1,46 @@ +// +// Subworkflow that uses the nf-schema plugin to validate parameters and render the parameter summary +// + +include { paramsSummaryLog } from 'plugin/nf-schema' +include { validateParameters } from 'plugin/nf-schema' + +workflow UTILS_NFSCHEMA_PLUGIN { + + take: + input_workflow // workflow: the workflow object used by nf-schema to get metadata from the workflow + validate_params // boolean: validate the parameters + parameters_schema // string: path to the parameters JSON schema. + // this has to be the same as the schema given to `validation.parametersSchema` + // when this input is empty it will automatically use the configured schema or + // "${projectDir}/nextflow_schema.json" as default. This input should not be empty + // for meta pipelines + + main: + + // + // Print parameter summary to stdout. This will display the parameters + // that differ from the default given in the JSON schema + // + if(parameters_schema) { + log.info paramsSummaryLog(input_workflow, parameters_schema:parameters_schema) + } else { + log.info paramsSummaryLog(input_workflow) + } + + // + // Validate the parameters using nextflow_schema.json or the schema + // given via the validation.parametersSchema configuration option + // + if(validate_params) { + if(parameters_schema) { + validateParameters(parameters_schema:parameters_schema) + } else { + validateParameters() + } + } + + emit: + dummy_emit = true +} + diff --git a/subworkflows/nf-core/utils_nfschema_plugin/meta.yml b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml new file mode 100644 index 000000000..f7d9f0288 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml @@ -0,0 +1,35 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "utils_nfschema_plugin" +description: Run nf-schema to validate parameters and create a summary of changed parameters +keywords: + - validation + - JSON schema + - plugin + - parameters + - summary +components: [] +input: + - input_workflow: + type: object + description: | + The workflow object of the used pipeline. + This object contains meta data used to create the params summary log + - validate_params: + type: boolean + description: Validate the parameters and error if invalid. + - parameters_schema: + type: string + description: | + Path to the parameters JSON schema. + This has to be the same as the schema given to the `validation.parametersSchema` config + option. When this input is empty it will automatically use the configured schema or + "${projectDir}/nextflow_schema.json" as default. The schema should not be given in this way + for meta pipelines. +output: + - dummy_emit: + type: boolean + description: Dummy emit to make nf-core subworkflows lint happy +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test new file mode 100644 index 000000000..842dc432a --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -0,0 +1,117 @@ +nextflow_workflow { + + name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" + script "../main.nf" + workflow "UTILS_NFSCHEMA_PLUGIN" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/utils_nfschema_plugin" + tag "plugin/nf-schema" + + config "./nextflow.config" + + test("Should run nothing") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } + + test("Should run nothing - custom schema") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params - custom schema") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config new file mode 100644 index 000000000..0907ac58f --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config @@ -0,0 +1,8 @@ +plugins { + id "nf-schema@2.1.0" +} + +validation { + parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + monochromeLogs = true +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json similarity index 95% rename from subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json rename to subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json index 7626c1c93..331e0d2f4 100644 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", "title": ". pipeline parameters", "description": "", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -87,10 +87,10 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf deleted file mode 100644 index 2585b65d1..000000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf +++ /dev/null @@ -1,62 +0,0 @@ -// -// Subworkflow that uses the nf-validation plugin to render help text and parameter summary -// - -/* -======================================================================================== - IMPORT NF-VALIDATION PLUGIN -======================================================================================== -*/ - -include { paramsHelp } from 'plugin/nf-validation' -include { paramsSummaryLog } from 'plugin/nf-validation' -include { validateParameters } from 'plugin/nf-validation' - -/* -======================================================================================== - SUBWORKFLOW DEFINITION -======================================================================================== -*/ - -workflow UTILS_NFVALIDATION_PLUGIN { - - take: - print_help // boolean: print help - workflow_command // string: default commmand used to run pipeline - pre_help_text // string: string to be printed before help text and summary log - post_help_text // string: string to be printed after help text and summary log - validate_params // boolean: validate parameters - schema_filename // path: JSON schema file, null to use default value - - main: - - log.debug "Using schema file: ${schema_filename}" - - // Default values for strings - pre_help_text = pre_help_text ?: '' - post_help_text = post_help_text ?: '' - workflow_command = workflow_command ?: '' - - // - // Print help message if needed - // - if (print_help) { - log.info pre_help_text + paramsHelp(workflow_command, parameters_schema: schema_filename) + post_help_text - System.exit(0) - } - - // - // Print parameter summary to stdout - // - log.info pre_help_text + paramsSummaryLog(workflow, parameters_schema: schema_filename) + post_help_text - - // - // Validate parameters relative to the parameter JSON schema - // - if (validate_params){ - validateParameters(parameters_schema: schema_filename) - } - - emit: - dummy_emit = true -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml deleted file mode 100644 index 3d4a6b04f..000000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json -name: "UTILS_NFVALIDATION_PLUGIN" -description: Use nf-validation to initiate and validate a pipeline -keywords: - - utility - - pipeline - - initialise - - validation -components: [] -input: - - print_help: - type: boolean - description: | - Print help message and exit - - workflow_command: - type: string - description: | - The command to run the workflow e.g. "nextflow run main.nf" - - pre_help_text: - type: string - description: | - Text to print before the help message - - post_help_text: - type: string - description: | - Text to print after the help message - - validate_params: - type: boolean - description: | - Validate the parameters and error if invalid. - - schema_filename: - type: string - description: | - The filename of the schema to validate against. -output: - - dummy_emit: - type: boolean - description: | - Dummy emit to make nf-core subworkflows lint happy -authors: - - "@adamrtalbot" -maintainers: - - "@adamrtalbot" - - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test deleted file mode 100644 index 5784a33f2..000000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test +++ /dev/null @@ -1,200 +0,0 @@ -nextflow_workflow { - - name "Test Workflow UTILS_NFVALIDATION_PLUGIN" - script "../main.nf" - workflow "UTILS_NFVALIDATION_PLUGIN" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "plugin/nf-validation" - tag "'plugin/nf-validation'" - tag "utils_nfvalidation_plugin" - tag "subworkflows/utils_nfvalidation_plugin" - - test("Should run nothing") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should run help") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with command") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with extra text") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = "pre-help-text" - post_help_text = "post-help-text" - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('pre-help-text') } }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } }, - { assert workflow.stdout.any { it.contains('post-help-text') } } - ) - } - } - - test("Should validate params") { - - when { - - params { - monochrome_logs = true - test_data = '' - outdir = 1 - } - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = true - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.failed }, - { assert workflow.stdout.any { it.contains('ERROR ~ ERROR: Validation of pipeline parameters failed!') } } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml deleted file mode 100644 index 60b1cfff4..000000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/utils_nfvalidation_plugin: - - subworkflows/nf-core/utils_nfvalidation_plugin/** diff --git a/workflows/eager.nf b/workflows/eager.nf index 96445f822..b5829842a 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -3,10 +3,9 @@ IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ - include { FASTQC } from '../modules/nf-core/fastqc/main' include { MULTIQC } from '../modules/nf-core/multiqc/main' -include { paramsSummaryMap } from 'plugin/nf-validation' +include { paramsSummaryMap } from 'plugin/nf-schema' include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_eager_pipeline' @@ -21,12 +20,10 @@ workflow EAGER { take: ch_samplesheet // channel: samplesheet read in from --input - main: ch_versions = Channel.empty() ch_multiqc_files = Channel.empty() - // // MODULE: Run FastQC // @@ -42,11 +39,12 @@ workflow EAGER { softwareVersionsToYAML(ch_versions) .collectFile( storeDir: "${params.outdir}/pipeline_info", - name: 'nf_core_pipeline_software_mqc_versions.yml', + name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', sort: true, newLine: true ).set { ch_collated_versions } + // // MODULE: MultiQC // @@ -59,18 +57,19 @@ workflow EAGER { Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() + summary_params = paramsSummaryMap( workflow, parameters_schema: "nextflow_schema.json") ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) - + ch_multiqc_files = ch_multiqc_files.mix( + ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) + ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) ch_methods_description = Channel.value( methodsDescriptionText(ch_multiqc_custom_methods_description)) - ch_multiqc_files = ch_multiqc_files.mix( - ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) ch_multiqc_files = ch_multiqc_files.mix( ch_methods_description.collectFile( @@ -83,12 +82,14 @@ workflow EAGER { ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) - emit: - multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + emit:multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html versions = ch_versions // channel: [ path(versions.yml) ] + } /* From 5346c8dfa60ad0468a4aa6d9c729e28a7065942c Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Wed, 9 Oct 2024 11:05:00 +0000 Subject: [PATCH 08/36] Template update for nf-core/tools version 3.0.1 --- .editorconfig | 4 - .github/CONTRIBUTING.md | 2 +- .github/workflows/awsfulltest.yml | 6 +- .github/workflows/linting.yml | 4 +- .nf-core.yml | 2 +- .prettierignore | 1 - docs/output.md | 1 - modules.json | 6 +- modules/nf-core/multiqc/environment.yml | 2 +- modules/nf-core/multiqc/main.nf | 4 +- .../nf-core/multiqc/tests/main.nf.test.snap | 26 +- nextflow.config | 8 +- .../local/utils_nfcore_eager_pipeline/main.nf | 12 +- .../nf-core/utils_nextflow_pipeline/main.nf | 46 ++- .../nf-core/utils_nfcore_pipeline/main.nf | 279 ++++++++++-------- 15 files changed, 209 insertions(+), 194 deletions(-) diff --git a/.editorconfig b/.editorconfig index e10588156..72dda289a 100644 --- a/.editorconfig +++ b/.editorconfig @@ -11,7 +11,6 @@ indent_style = space [*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 - # These files are edited and tested upstream in nf-core/modules [/modules/nf-core/**] charset = unset @@ -26,12 +25,9 @@ insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset - - [/assets/email*] indent_size = unset - # ignore python and markdown [*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index ad17de748..d75c30f7a 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -90,7 +90,7 @@ Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json ### Default processes resource requirements -Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. +Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/main/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index d0225079a..454f353ea 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -14,16 +14,18 @@ on: jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/eager' && github.event.review.state == 'approved' + # run only if the PR is approved by at least 2 reviewers and against the master branch or manually triggered + if: github.repository == 'nf-core/eager' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: - uses: octokit/request-action@v2.x id: check_approvals with: - route: GET /repos/${{ github.repository }}/pulls/${{ github.event.review.number }}/reviews + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews env: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} - id: test_variables + if: github.event_name != 'workflow_dispatch' run: | JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index b882838af..a502573c5 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -42,10 +42,10 @@ jobs: architecture: "x64" - name: read .nf-core.yml - uses: pietrobolcato/action-read-yaml@1.0.0 + uses: pietrobolcato/action-read-yaml@1.1.0 id: read_yml with: - config: ${{ github.workspace }}/.nf-core.yaml + config: ${{ github.workspace }}/.nf-core.yml - name: Install dependencies run: | diff --git a/.nf-core.yml b/.nf-core.yml index 0a56bace8..63cc99379 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -3,7 +3,7 @@ lint: nextflow_config: - config_defaults: - params.contamination_estimation_angsd_hapmap -nf_core_version: 3.0.0 +nf_core_version: 3.0.1 org_path: null repository_type: pipeline template: diff --git a/.prettierignore b/.prettierignore index 610e50692..437d763d0 100644 --- a/.prettierignore +++ b/.prettierignore @@ -1,4 +1,3 @@ - email_template.html adaptivecard.json slackreport.json diff --git a/docs/output.md b/docs/output.md index fd09d59cf..f4a245749 100644 --- a/docs/output.md +++ b/docs/output.md @@ -14,7 +14,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - [FastQC](#fastqc) - Raw read QC - [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline - - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC diff --git a/modules.json b/modules.json index 3d8d7b1a7..66fd4cf19 100644 --- a/modules.json +++ b/modules.json @@ -12,7 +12,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", "installed_by": ["modules"] } } @@ -21,12 +21,12 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "d20fb2a9cc3e2835e9d067d1046a63252eb17352", + "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "2fdce49d30c0254f76bc0f13c55c17455c1251ab", + "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index f1cd99b07..6f5b867b7 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -2,4 +2,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::multiqc=1.24.1 + - bioconda::multiqc=1.25.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index b9ccebdbb..9724d2f34 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,8 +3,8 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.25--pyhdfd78af_0' : - 'biocontainers/multiqc:1.25--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index b779e4692..2fcbb5ff7 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T12:41:34.562023" + "timestamp": "2024-10-02T17:51:46.317523" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T11:27:11.933869532" + "timestamp": "2024-10-02T17:52:20.680978" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T11:26:56.709849369" + "timestamp": "2024-10-02T17:52:09.185842" } -} +} \ No newline at end of file diff --git a/nextflow.config b/nextflow.config index 847c09fc0..eabe9dce8 100644 --- a/nextflow.config +++ b/nextflow.config @@ -12,10 +12,12 @@ params { // TODO nf-core: Specify your pipeline's command line flags // Input options input = null + // References genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false + // MultiQC options multiqc_config = null multiqc_title = null @@ -36,6 +38,7 @@ params { show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' + // Config options config_profile_name = null config_profile_description = null @@ -44,9 +47,9 @@ params { custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null + // Schema validation default options validate_params = true - } // Load base.config by default for all pipelines @@ -161,6 +164,7 @@ includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${pa // Load nf-core/eager custom profiles from different institutions. // TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs // includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/eager.config" : "/dev/null" + // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled // Set to your registry if you have a mirror of containers @@ -172,6 +176,7 @@ charliecloud.registry = 'quay.io' // Load igenomes.config if required includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' + // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -263,4 +268,3 @@ validation { // Load modules.config for DSL2 module specific options includeConfig 'conf/modules.config' - diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index b7b66db7a..0fe2b261e 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -18,9 +18,9 @@ include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW TO INITIALISE PIPELINE -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_INITIALISATION { @@ -99,9 +99,9 @@ workflow PIPELINE_INITIALISATION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW FOR PIPELINE COMPLETION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_COMPLETION { @@ -147,9 +147,9 @@ workflow PIPELINE_COMPLETION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // // Check and validate pipeline parameters diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 28e32b200..2b0dc67a6 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,13 +3,12 @@ // /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { - take: print_version // boolean: print version dump_parameters // boolean: dump parameters @@ -22,7 +21,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Print workflow version and exit on --version // if (print_version) { - log.info "${workflow.manifest.name} ${getWorkflowVersion()}" + log.info("${workflow.manifest.name} ${getWorkflowVersion()}") System.exit(0) } @@ -45,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -72,11 +71,11 @@ def getWorkflowVersion() { // Dump pipeline parameters to a JSON file // def dumpParametersToJSON(outdir) { - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def filename = "params_${timestamp}.json" - def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = groovy.json.JsonOutput.toJson(params) - temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) + def timestamp = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() @@ -91,9 +90,14 @@ def checkCondaChannels() { try { def config = parser.load("conda config --show channels".execute().text) channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return + } + catch (NullPointerException e) { + log.warn("Could not verify conda channel configuration.") + return null + } + catch (IOException e) { + log.warn("Could not verify conda channel configuration.") + return null } // Check that all channels are present @@ -106,19 +110,13 @@ def checkCondaChannels() { required_channels_in_order.eachWithIndex { channel, index -> if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index+1])) + channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) } } if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + log.warn( + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + ) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index cbd8495bb..b78273ca4 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,13 +3,12 @@ // /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { - take: nextflow_cli_args @@ -22,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -33,12 +32,9 @@ workflow UTILS_NFCORE_PIPELINE { def checkConfigProvided() { def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " + log.warn( + "[${workflow.manifest.name}] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + "Please refer to the quick start section and usage docs for the pipeline.\n " + ) valid_config = false } return valid_config @@ -49,12 +45,14 @@ def checkConfigProvided() { // def checkProfileProvided(nextflow_cli_args) { if (workflow.profile.endsWith(',')) { - error "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + error( + "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } if (nextflow_cli_args[0]) { - log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + log.warn( + "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } } @@ -70,13 +68,7 @@ def workflowCitation() { manifest_doi.each { doi_ref -> temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" } - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline\n" + - temp_doi_ref + "\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + "* The nf-core framework\n" + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + "* Software dependencies\n" + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" } // @@ -102,7 +94,7 @@ def getWorkflowVersion() { // def processVersionsFromYAML(yaml_file) { def yaml = new org.yaml.snakeyaml.Yaml() - def versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def versions = yaml.load(yaml_file).collectEntries { k, v -> [k.tokenize(':')[-1], v] } return yaml.dumpAsMap(versions).trim() } @@ -112,8 +104,8 @@ def processVersionsFromYAML(yaml_file) { def workflowVersionToYAML() { return """ Workflow: - $workflow.manifest.name: ${getWorkflowVersion()} - Nextflow: $workflow.nextflow.version + ${workflow.manifest.name}: ${getWorkflowVersion()} + Nextflow: ${workflow.nextflow.version} """.stripIndent().trim() } @@ -121,11 +113,7 @@ def workflowVersionToYAML() { // Get channel of software versions used in pipeline in YAML format // def softwareVersionsToYAML(ch_versions) { - return ch_versions - .unique() - .map { version -> processVersionsFromYAML(version) } - .unique() - .mix(Channel.of(workflowVersionToYAML())) + return ch_versions.unique().map { version -> processVersionsFromYAML(version) }.unique().mix(Channel.of(workflowVersionToYAML())) } // @@ -133,25 +121,31 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - summary_params.keySet().each { group -> - def group_params = summary_params.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

    $group

    \n" - summary_section += "
    \n" - group_params.keySet().sort().each { param -> - summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" + summary_params + .keySet() + .each { group -> + def group_params = summary_params.get(group) + // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    ${group}

    \n" + summary_section += "
    \n" + group_params + .keySet() + .sort() + .each { param -> + summary_section += "
    ${param}
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" } - summary_section += "
    \n" } - } - def yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" as String - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/', '-')}-summary'\n" as String + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" return yaml_file_text } @@ -199,54 +193,54 @@ def logColours(monochrome_logs=true) { colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" return colorcodes } @@ -261,14 +255,15 @@ def attachMultiqcReport(multiqc_report) { mqc_report = multiqc_report.getVal() if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") } mqc_report = mqc_report[0] } } - } catch (all) { + } + catch (Exception all) { if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" + log.warn("[${workflow.manifest.name}] Could not attach MultiQC report to summary email") } } return mqc_report @@ -280,26 +275,35 @@ def attachMultiqcReport(multiqc_report) { def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" + def subject = "[${workflow.manifest.name}] Successful: ${workflow.runName}" if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" + subject = "[${workflow.manifest.name}] FAILED: ${workflow.runName}" } def summary = [:] - summary_params.keySet().sort().each { group -> - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] misc_fields['Date Started'] = workflow.start misc_fields['Date Completed'] = workflow.complete misc_fields['Pipeline script file path'] = workflow.scriptFile misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build + if (workflow.repository) { + misc_fields['Pipeline repository Git URL'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['Pipeline repository Git Commit'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['Pipeline Git branch/tag'] = workflow.revision + } + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp def email_fields = [:] @@ -337,7 +341,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Render the sendmail template def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] + def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) def sendmail_html = sendmail_template.toString() @@ -346,30 +350,32 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { +new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { + ['sendmail', '-t'].execute() << sendmail_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") + } + catch (Exception all) { // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] + def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (mail)-") } } // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html") output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt") output_tf.delete() } @@ -380,12 +386,14 @@ def completionSummary(monochrome_logs=true) { def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Pipeline completed successfully${colors.reset}-") + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-") } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.red} Pipeline completed with errors${colors.reset}-") } } @@ -394,21 +402,30 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - summary_params.keySet().sort().each { group -> - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) { + misc_fields['repository'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['commitid'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['revision'] = workflow.revision + } + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp def msg_fields = [:] msg_fields['version'] = getWorkflowVersion() @@ -433,13 +450,13 @@ def imNotification(summary_params, hook_url) { def json_message = json_template.toString() // POST - def post = new URL(hook_url).openConnection(); + def post = new URL(hook_url).openConnection() post.setRequestMethod("POST") post.setDoOutput(true) post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); + post.getOutputStream().write(json_message.getBytes("UTF-8")) + def postRC = post.getResponseCode() + if (!postRC.equals(200)) { + log.warn(post.getErrorStream().getText()) } } From 8677fbe93333177d0780efa8d415dbb2dd14f87d Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Fri, 11 Oct 2024 12:34:14 +0000 Subject: [PATCH 09/36] Template update for nf-core/tools version 3.0.2 --- .github/workflows/ci.yml | 60 +++++++++++++------ .../workflows/template_version_comment.yml | 21 ++++--- .gitignore | 1 + .nf-core.yml | 2 +- main.nf | 2 +- modules.json | 6 +- modules/nf-core/multiqc/main.nf | 2 +- nextflow.config | 4 +- .../local/utils_nfcore_eager_pipeline/main.nf | 4 +- .../nf-core/utils_nextflow_pipeline/main.nf | 30 +++++----- .../nf-core/utils_nfcore_pipeline/main.nf | 10 ++-- workflows/eager.nf | 2 - 12 files changed, 86 insertions(+), 58 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 9917a508f..fb55614ca 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -11,6 +11,8 @@ on: env: NXF_ANSI_LOG: false + NXF_SINGULARITY_CACHEDIR: ${{ github.workspace }}/.singularity + NXF_SINGULARITY_LIBRARYDIR: ${{ github.workspace }}/.singularity concurrency: group: "${{ github.workflow }}-${{ github.event.pull_request.number || github.ref }}" @@ -18,7 +20,7 @@ concurrency: jobs: test: - name: Run pipeline with test data + name: "Run pipeline with test data (${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }})" # Only run on push if this is the nf-core dev branch (merged PRs) if: "${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/eager') }}" runs-on: ubuntu-latest @@ -27,33 +29,57 @@ jobs: NXF_VER: - "24.04.2" - "latest-everything" + profile: + - "conda" + - "docker" + - "singularity" + test_name: + - "test" + isMaster: + - ${{ github.base_ref == 'master' }} + # Exclude conda and singularity on dev + exclude: + - isMaster: false + profile: "conda" + - isMaster: false + profile: "singularity" steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - - name: Install Nextflow + - name: Set up Nextflow uses: nf-core/setup-nextflow@v2 with: version: "${{ matrix.NXF_VER }}" - - name: Disk space cleanup - uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 + - name: Set up Apptainer + if: matrix.profile == 'singularity' + uses: eWaterCycle/setup-apptainer@main - - name: Run pipeline with test data (docker) - # TODO nf-core: You can customise CI pipeline run tests as required - # For example: adding multiple test runs with different parameters - # Remember that you can parallelise this by using strategy.matrix + - name: Set up Singularity + if: matrix.profile == 'singularity' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker --outdir ./results + mkdir -p $NXF_SINGULARITY_CACHEDIR + mkdir -p $NXF_SINGULARITY_LIBRARYDIR + + - name: Set up Miniconda + if: matrix.profile == 'conda' + uses: conda-incubator/setup-miniconda@a4260408e20b96e80095f42ff7f1a15b27dd94ca # v3 + with: + miniconda-version: "latest" + auto-update-conda: true + conda-solver: libmamba + channels: conda-forge,bioconda - - name: Run pipeline with test data (singularity) - # TODO nf-core: You can customise CI pipeline run tests as required + - name: Set up Conda + if: matrix.profile == 'conda' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,singularity --outdir ./results - if: "${{ github.base_ref == 'master' }}" + echo $(realpath $CONDA)/condabin >> $GITHUB_PATH + echo $(realpath python) >> $GITHUB_PATH + + - name: Clean up Disk space + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data (conda) - # TODO nf-core: You can customise CI pipeline run tests as required + - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,conda --outdir ./results - if: "${{ github.base_ref == 'master' }}" + nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} --outdir ./results diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml index 9dea41f0d..e8aafe44d 100644 --- a/.github/workflows/template_version_comment.yml +++ b/.github/workflows/template_version_comment.yml @@ -10,9 +10,11 @@ jobs: steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + with: + ref: ${{ github.event.pull_request.head.sha }} - name: Read template version from .nf-core.yml - uses: pietrobolcato/action-read-yaml@1.0.0 + uses: nichmor/minimal-read-yaml@v0.0.2 id: read_yml with: config: ${{ github.workspace }}/.nf-core.yml @@ -24,20 +26,21 @@ jobs: - name: Check nf-core outdated id: nf_core_outdated - run: pip list --outdated | grep nf-core + run: echo "OUTPUT=$(pip list --outdated | grep nf-core)" >> ${GITHUB_ENV} - name: Post nf-core template version comment uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 if: | - ${{ steps.nf_core_outdated.outputs.stdout }} =~ 'nf-core' + contains(env.OUTPUT, 'nf-core') with: repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} allow-repeats: false message: | - ## :warning: Newer version of the nf-core template is available. - - Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. - Please update your pipeline to the latest version. - - For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + > [!WARNING] + > Newer version of the nf-core template is available. + > + > Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + > Please update your pipeline to the latest version. + > + > For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). # diff --git a/.gitignore b/.gitignore index 5124c9ac7..a42ce0162 100644 --- a/.gitignore +++ b/.gitignore @@ -6,3 +6,4 @@ results/ testing/ testing* *.pyc +null/ diff --git a/.nf-core.yml b/.nf-core.yml index 63cc99379..4ec9275ea 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -3,7 +3,7 @@ lint: nextflow_config: - config_defaults: - params.contamination_estimation_angsd_hapmap -nf_core_version: 3.0.1 +nf_core_version: 3.0.2 org_path: null repository_type: pipeline template: diff --git a/main.nf b/main.nf index 4facc4faa..b81969752 100644 --- a/main.nf +++ b/main.nf @@ -76,7 +76,7 @@ workflow { params.outdir, params.input ) - + // // WORKFLOW: Run main workflow // diff --git a/modules.json b/modules.json index 66fd4cf19..da2f22408 100644 --- a/modules.json +++ b/modules.json @@ -12,7 +12,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] } } @@ -21,12 +21,12 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", + "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", + "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 9724d2f34..cc0643e1d 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -52,7 +52,7 @@ process MULTIQC { stub: """ mkdir multiqc_data - touch multiqc_plots + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/nextflow.config b/nextflow.config index eabe9dce8..1257bf58d 100644 --- a/nextflow.config +++ b/nextflow.config @@ -254,10 +254,10 @@ validation { """ afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} * The nf-core framework - https://doi.org/10.1038/s41587-020-0439-x + https://doi.org/10.1038/s41587-020-0439-x * Software dependencies - https://github.com/${manifest.name}/blob/master/CITATIONS.md + https://github.com/${manifest.name}/blob/master/CITATIONS.md """ } summary { diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index 0fe2b261e..4f207d98e 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -47,7 +47,6 @@ workflow PIPELINE_INITIALISATION { workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 ) - // // Validate parameters and generate parameter summary to stdout // @@ -56,7 +55,6 @@ workflow PIPELINE_INITIALISATION { validate_params, null ) - // // Check config provided to the pipeline @@ -64,6 +62,7 @@ workflow PIPELINE_INITIALISATION { UTILS_NFCORE_PIPELINE ( nextflow_cli_args ) + // // Custom validation for pipeline parameters // @@ -110,7 +109,6 @@ workflow PIPELINE_COMPLETION { email // string: email address email_on_fail // string: email address sent on pipeline failure plaintext_email // boolean: Send plain-text email instead of HTML - outdir // path: Path to output directory where results will be published monochrome_logs // boolean: Disable ANSI colour codes in log output hook_url // string: hook URL for notifications diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 2b0dc67a6..0fcbf7b3f 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { @@ -44,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -106,17 +106,19 @@ def checkCondaChannels() { def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order - def channel_priority_violation = false - - required_channels_in_order.eachWithIndex { channel, index -> - if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) - } - } + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } if (channels_missing | channel_priority_violation) { - log.warn( - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - ) + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index b78273ca4..5cb7bafef 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { @@ -21,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -62,7 +62,7 @@ def checkProfileProvided(nextflow_cli_args) { def workflowCitation() { def temp_doi_ref = "" def manifest_doi = workflow.manifest.doi.tokenize(",") - // Using a loop to handle multiple DOIs + // Handling multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list manifest_doi.each { doi_ref -> diff --git a/workflows/eager.nf b/workflows/eager.nf index b5829842a..57a93f489 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -57,13 +57,11 @@ workflow EAGER { Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() - summary_params = paramsSummaryMap( workflow, parameters_schema: "nextflow_schema.json") ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) ch_multiqc_files = ch_multiqc_files.mix( ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) - ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) From 7b7ef2affeb11bda2a80d2eaf1a6aead3710fd15 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 14:38:33 +0200 Subject: [PATCH 10/36] Also use correct function for validating fasta input sheet --- .gitignore | 1 + .../local/reference_indexing_multi.nf | 237 ++++++++---------- 2 files changed, 108 insertions(+), 130 deletions(-) diff --git a/.gitignore b/.gitignore index a42ce0162..23b0c7de9 100644 --- a/.gitignore +++ b/.gitignore @@ -7,3 +7,4 @@ testing/ testing* *.pyc null/ +.nf-test* diff --git a/subworkflows/local/reference_indexing_multi.nf b/subworkflows/local/reference_indexing_multi.nf index 00276a5b9..8a5b946fd 100644 --- a/subworkflows/local/reference_indexing_multi.nf +++ b/subworkflows/local/reference_indexing_multi.nf @@ -7,9 +7,9 @@ include { BWA_INDEX } from '../../modules/nf-core/bwa/inde include { BOWTIE2_BUILD } from '../../modules/nf-core/bowtie2/build/main' include { SAMTOOLS_FAIDX } from '../../modules/nf-core/samtools/faidx/main' include { PICARD_CREATESEQUENCEDICTIONARY } from '../../modules/nf-core/picard/createsequencedictionary/main' +include { samplesheetToList } from 'plugin/nf-schema' workflow REFERENCE_INDEXING_MULTI { - take: referencesheet // file: /path/to/name.{csv,tsv} @@ -17,28 +17,28 @@ workflow REFERENCE_INDEXING_MULTI { ch_versions = Channel.empty() // Import reference sheet and change empty arrays to empty strings for compatibility with single reference input - ch_splitreferencesheet_for_branch = Channel.fromSamplesheet("fasta_sheet") - .map{ - meta, fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp -> - meta.ploidy = meta.genotyping_ploidy != null ? meta.genotyping_ploidy : params.genotyping_reference_ploidy - fai = fai != [] ? fai : "" - dict = dict != [] ? dict : "" - mapper_index = mapper_index != [] ? mapper_index : "" - circular_target = circular_target != [] ? circular_target : "" - circularmapper_elongatedfasta = circularmapper_elongatedfasta != [] ? circularmapper_elongatedfasta : "" - circularmapper_elongatedindex = circularmapper_elongatedindex != [] ? circularmapper_elongatedindex : "" - mitochondrion = mitochondrion != [] ? mitochondrion : "" - capture_bed = capture_bed != [] ? capture_bed : "" - pileupcaller_bed = pileupcaller_bed != [] ? pileupcaller_bed : "" - pileupcaller_snp = pileupcaller_snp != [] ? pileupcaller_snp : "" - hapmap = hapmap != [] ? hapmap : "" - pmd_masked_fasta = pmd_masked_fasta != [] ? pmd_masked_fasta : "" - pmd_bed_for_masking = pmd_bed_for_masking != [] ? pmd_bed_for_masking : "" - sexdet_bed = sexdet_bed != [] ? sexdet_bed : "" - bedtools_feature = bedtools_feature != [] ? bedtools_feature : "" - genotyping_gatk_dbsnp = genotyping_gatk_dbsnp != [] ? genotyping_gatk_dbsnp : "" - [ meta - meta.subMap('genotyping_ploidy'), fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp ] - } + ch_splitreferencesheet_for_branch = Channel + .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_fasta.json")) + .map { meta, fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp -> + meta.ploidy = meta.genotyping_ploidy != null ? meta.genotyping_ploidy : params.genotyping_reference_ploidy + fai = fai != [] ? fai : "" + dict = dict != [] ? dict : "" + mapper_index = mapper_index != [] ? mapper_index : "" + circular_target = circular_target != [] ? circular_target : "" + circularmapper_elongatedfasta = circularmapper_elongatedfasta != [] ? circularmapper_elongatedfasta : "" + circularmapper_elongatedindex = circularmapper_elongatedindex != [] ? circularmapper_elongatedindex : "" + mitochondrion = mitochondrion != [] ? mitochondrion : "" + capture_bed = capture_bed != [] ? capture_bed : "" + pileupcaller_bed = pileupcaller_bed != [] ? pileupcaller_bed : "" + pileupcaller_snp = pileupcaller_snp != [] ? pileupcaller_snp : "" + hapmap = hapmap != [] ? hapmap : "" + pmd_masked_fasta = pmd_masked_fasta != [] ? pmd_masked_fasta : "" + pmd_bed_for_masking = pmd_bed_for_masking != [] ? pmd_bed_for_masking : "" + sexdet_bed = sexdet_bed != [] ? sexdet_bed : "" + bedtools_feature = bedtools_feature != [] ? bedtools_feature : "" + genotyping_gatk_dbsnp = genotyping_gatk_dbsnp != [] ? genotyping_gatk_dbsnp : "" + [meta - meta.subMap('genotyping_ploidy'), fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp] + } // GENERAL DESCRIPTION FOR NEXT SECTIONS // This will be the same scheme for all other generation steps, i.e. @@ -51,44 +51,38 @@ workflow REFERENCE_INDEXING_MULTI { // DECOMPRESSION // - ch_input_from_referencesheet = ch_splitreferencesheet_for_branch - .multiMap { - meta, fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp -> - generated: [ meta, fasta, fai, dict, mapper_index ] - circularmapper: [ meta, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex ] - mitochondrion_header: [ meta, mitochondrion ] - angsd_hapmap: [ meta, hapmap ] - pmd_masked_fasta: [ meta, pmd_masked_fasta ] - pmd_bed_for_masking: [ meta, pmd_bed_for_masking ] - snp_bed: [ meta, capture_bed ] - pileupcaller_bed_snp: [ meta, pileupcaller_bed, pileupcaller_snp ] - sexdeterrmine_bed: [ meta, sexdet_bed ] - bedtools_feature: [ meta, bedtools_feature ] - dbsnp: [ meta, genotyping_gatk_dbsnp ] - } + ch_input_from_referencesheet = ch_splitreferencesheet_for_branch.multiMap { meta, fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp -> + generated: [meta, fasta, fai, dict, mapper_index] + circularmapper: [meta, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex] + mitochondrion_header: [meta, mitochondrion] + angsd_hapmap: [meta, hapmap] + pmd_masked_fasta: [meta, pmd_masked_fasta] + pmd_bed_for_masking: [meta, pmd_bed_for_masking] + snp_bed: [meta, capture_bed] + pileupcaller_bed_snp: [meta, pileupcaller_bed, pileupcaller_snp] + sexdeterrmine_bed: [meta, sexdet_bed] + bedtools_feature: [meta, bedtools_feature] + dbsnp: [meta, genotyping_gatk_dbsnp] + } // Detect if fasta is gzipped or not - ch_fasta_for_gunzip = ch_input_from_referencesheet.generated - .branch { - meta, fasta, fai, dict, mapper_index -> - forgunzip: fasta.extension == "gz" - skip: true - } + ch_fasta_for_gunzip = ch_input_from_referencesheet.generated.branch { meta, fasta, fai, dict, mapper_index -> + forgunzip: fasta.extension == "gz" + skip: true + } // Pull out name/file to match cardinality for GUNZIP module - ch_gunzip_input = ch_fasta_for_gunzip.forgunzip - .multiMap { - meta, fasta, fai, dict, mapper_index -> - gunzip: [ meta, fasta ] - remainder: [ meta, fai, dict, mapper_index ] - } + ch_gunzip_input = ch_fasta_for_gunzip.forgunzip.multiMap { meta, fasta, fai, dict, mapper_index -> + gunzip: [meta, fasta] + remainder: [meta, fai, dict, mapper_index] + } - GUNZIP_FASTA ( ch_gunzip_input.gunzip ) - ch_version = ch_versions.mix( GUNZIP_FASTA.out.versions ) + GUNZIP_FASTA(ch_gunzip_input.gunzip) + ch_version = ch_versions.mix(GUNZIP_FASTA.out.versions) // Mix back gunzipped fasta with remaining files, and then mix back with pre-gunzipped references - ch_gunzippedfasta_formix = GUNZIP_FASTA.out.gunzip.join( ch_gunzip_input.remainder, failOnMismatch: true ) + ch_gunzippedfasta_formix = GUNZIP_FASTA.out.gunzip.join(ch_gunzip_input.remainder, failOnMismatch: true) ch_fasta_for_faiindexing = ch_fasta_for_gunzip.skip.mix(ch_gunzippedfasta_formix) // @@ -96,33 +90,27 @@ workflow REFERENCE_INDEXING_MULTI { // // Separate out non-faidxed references - ch_fasta_for_faidx = ch_fasta_for_faiindexing - .branch { - meta, fasta, fai, dict, mapper_index -> - forfaidx: fai == "" - skip: true - } + ch_fasta_for_faidx = ch_fasta_for_faiindexing.branch { meta, fasta, fai, dict, mapper_index -> + forfaidx: fai == "" + skip: true + } // Split channel to ensure cardinality matching - ch_faidx_input = ch_fasta_for_faidx - .forfaidx - .multiMap { - meta, fasta, fai, dict, mapper_index -> - faidx: [ meta, fasta ] - remainder: [ meta, fasta, dict, mapper_index ] // we drop fai here as we are going to make it - } + ch_faidx_input = ch_fasta_for_faidx.forfaidx.multiMap { meta, fasta, fai, dict, mapper_index -> + faidx: [meta, fasta] + remainder: [meta, fasta, dict, mapper_index] + } - SAMTOOLS_FAIDX ( ch_faidx_input.faidx, [ [], [] ] ) - ch_version = ch_versions.mix( SAMTOOLS_FAIDX.out.versions ) + SAMTOOLS_FAIDX(ch_faidx_input.faidx, [[], []]) + ch_version = ch_versions.mix(SAMTOOLS_FAIDX.out.versions) // Rejoin output channel with main reference indicies channel elements - ch_faidxed_formix = SAMTOOLS_FAIDX.out.fai - .join( ch_faidx_input.remainder, failOnMismatch: true ) - .map { - meta, fai, fasta, dict, mapper_index -> + ch_faidxed_formix = SAMTOOLS_FAIDX.out.fai + .join(ch_faidx_input.remainder, failOnMismatch: true) + .map { meta, fai, fasta, dict, mapper_index -> - [ meta, fasta, fai, dict, mapper_index ] - } + [meta, fasta, fai, dict, mapper_index] + } // Mix back newly faidx'd references with the pre-indexed ones ch_fasta_for_dictindexing = ch_fasta_for_faidx.skip.mix(ch_faidxed_formix) @@ -131,31 +119,25 @@ workflow REFERENCE_INDEXING_MULTI { // INDEXING: dict // - ch_fasta_for_dict = ch_fasta_for_dictindexing - .branch { - meta, fasta, fai, dict, mapper_index -> - fordict: dict == "" - skip: true - } + ch_fasta_for_dict = ch_fasta_for_dictindexing.branch { meta, fasta, fai, dict, mapper_index -> + fordict: dict == "" + skip: true + } - ch_dict_input = ch_fasta_for_dict - .fordict - .multiMap { - meta, fasta, fai, dict, mapper_index -> - dict: [ meta, fasta ] - remainder: [ meta, fasta, fai, mapper_index ] - } + ch_dict_input = ch_fasta_for_dict.fordict.multiMap { meta, fasta, fai, dict, mapper_index -> + dict: [meta, fasta] + remainder: [meta, fasta, fai, mapper_index] + } - PICARD_CREATESEQUENCEDICTIONARY ( ch_dict_input.dict ) - ch_version = ch_versions.mix( PICARD_CREATESEQUENCEDICTIONARY.out.versions ) + PICARD_CREATESEQUENCEDICTIONARY(ch_dict_input.dict) + ch_version = ch_versions.mix(PICARD_CREATESEQUENCEDICTIONARY.out.versions) - ch_dicted_formix = PICARD_CREATESEQUENCEDICTIONARY.out.reference_dict - .join( ch_dict_input.remainder, failOnMismatch: true ) - .map { - meta, dict, fasta, fai, mapper_index -> + ch_dicted_formix = PICARD_CREATESEQUENCEDICTIONARY.out.reference_dict + .join(ch_dict_input.remainder, failOnMismatch: true) + .map { meta, dict, fasta, fai, mapper_index -> - [ meta, fasta, fai, dict, mapper_index ] - } + [meta, fasta, fai, dict, mapper_index] + } ch_dict_formapperindexing = ch_fasta_for_dict.skip.mix(ch_dicted_formix) @@ -165,52 +147,47 @@ workflow REFERENCE_INDEXING_MULTI { // Generate mapper indicies if not supplied, and if supplied generate meta - ch_fasta_for_mapperindex = ch_dict_formapperindexing - .branch { - meta, fasta, fai, dict, mapper_index -> - forindex: mapper_index == "" - skip: true - } + ch_fasta_for_mapperindex = ch_dict_formapperindexing.branch { meta, fasta, fai, dict, mapper_index -> + forindex: mapper_index == "" + skip: true + } - ch_mapindex_input = ch_fasta_for_mapperindex - .forindex - .multiMap { - meta, fasta, fai, dict, mapper_index -> - index: [ meta, fasta ] - remainder: [ meta, fasta, fai, dict ] - } + ch_mapindex_input = ch_fasta_for_mapperindex.forindex.multiMap { meta, fasta, fai, dict, mapper_index -> + index: [meta, fasta] + remainder: [meta, fasta, fai, dict] + } - if ( params.mapping_tool == "bwaaln" || params.mapping_tool == "bwamem" || params.mapping_tool == "circularmapper" ) { - BWA_INDEX ( ch_mapindex_input.index ) - ch_version = ch_versions.mix( BWA_INDEX.out.versions ) + if (params.mapping_tool == "bwaaln" || params.mapping_tool == "bwamem" || params.mapping_tool == "circularmapper") { + BWA_INDEX(ch_mapindex_input.index) + ch_version = ch_versions.mix(BWA_INDEX.out.versions) ch_indexed_forremap = BWA_INDEX.out.index - } else if ( params.mapping_tool == "bowtie2" ) { - BOWTIE2_BUILD ( ch_mapindex_input.index ) - ch_version = ch_versions.mix( BOWTIE2_BUILD.out.versions ) + } + else if (params.mapping_tool == "bowtie2") { + BOWTIE2_BUILD(ch_mapindex_input.index) + ch_version = ch_versions.mix(BOWTIE2_BUILD.out.versions) ch_indexed_forremap = BOWTIE2_BUILD.out.index } ch_indexed_formix = ch_indexed_forremap - .join( ch_mapindex_input.remainder, failOnMismatch: true ) - .map { - meta, mapper_index, fasta, fai, dict -> + .join(ch_mapindex_input.remainder, failOnMismatch: true) + .map { meta, mapper_index, fasta, fai, dict -> - [ meta, fasta, fai, dict, mapper_index ] - } + [meta, fasta, fai, dict, mapper_index] + } ch_indexmapper_for_reference = ch_fasta_for_mapperindex.skip.mix(ch_indexed_formix) emit: - reference = ch_indexmapper_for_reference // [ meta, fasta, fai, dict, mapindex ] - elongated_reference = ch_input_from_referencesheet.circularmapper // [ meta, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex ] - mitochondrion_header = ch_input_from_referencesheet.mitochondrion_header // [ meta, mitochondrion ] - hapmap = ch_input_from_referencesheet.angsd_hapmap // [ meta, hapmap ] - pmd_masked_fasta = ch_input_from_referencesheet.pmd_masked_fasta // [ meta, pmd_masked_fasta ] - pmd_bed_for_masking = ch_input_from_referencesheet.pmd_bed_for_masking // [ meta, pmd_bed_for_masking ] - snp_capture_bed = ch_input_from_referencesheet.snp_bed // [ meta, capture_bed ] - pileupcaller_bed_snp = ch_input_from_referencesheet.pileupcaller_bed_snp // [ meta, pileupcaller_bed, pileupcaller_snp ] - sexdeterrmine_bed = ch_input_from_referencesheet.sexdeterrmine_bed // [ meta, sexdet_bed ] - bedtools_feature = ch_input_from_referencesheet.bedtools_feature // [ meta, bedtools_feature ] - dbsnp = ch_input_from_referencesheet.dbsnp // [ meta, genotyping_gatk_dbsnp ] + reference = ch_indexmapper_for_reference // [ meta, fasta, fai, dict, mapindex ] + elongated_reference = ch_input_from_referencesheet.circularmapper // [ meta, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex ] + mitochondrion_header = ch_input_from_referencesheet.mitochondrion_header // [ meta, mitochondrion ] + hapmap = ch_input_from_referencesheet.angsd_hapmap // [ meta, hapmap ] + pmd_masked_fasta = ch_input_from_referencesheet.pmd_masked_fasta // [ meta, pmd_masked_fasta ] + pmd_bed_for_masking = ch_input_from_referencesheet.pmd_bed_for_masking // [ meta, pmd_bed_for_masking ] + snp_capture_bed = ch_input_from_referencesheet.snp_bed // [ meta, capture_bed ] + pileupcaller_bed_snp = ch_input_from_referencesheet.pileupcaller_bed_snp // [ meta, pileupcaller_bed, pileupcaller_snp ] + sexdeterrmine_bed = ch_input_from_referencesheet.sexdeterrmine_bed // [ meta, sexdet_bed ] + bedtools_feature = ch_input_from_referencesheet.bedtools_feature // [ meta, bedtools_feature ] + dbsnp = ch_input_from_referencesheet.dbsnp // [ meta, genotyping_gatk_dbsnp ] versions = ch_versions } From b30edb119b775c9ba67a3e676354ec6489c2f7e7 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 14:52:50 +0200 Subject: [PATCH 11/36] Remove cehckmax --- conf/test_humanbam.config | 37 ++++++++++++++++++++----------------- conf/test_kraken2.config | 20 +++++++++++--------- conf/test_krakenuniq.config | 21 ++++++++++++--------- conf/test_malt.config | 21 ++++++++++++--------- conf/test_metaphlan.config | 21 ++++++++++++--------- conf/test_multiref.config | 31 ++++++++++++++++--------------- conf/test_nothing.config | 32 +++++++++++++++++--------------- 7 files changed, 100 insertions(+), 83 deletions(-) diff --git a/conf/test_humanbam.config b/conf/test_humanbam.config index b60988019..21c35179f 100644 --- a/conf/test_humanbam.config +++ b/conf/test_humanbam.config @@ -10,43 +10,46 @@ ---------------------------------------------------------------------------------------- */ -params { - config_profile_name = 'Human BAM test profile' - config_profile_description = 'Minimal test dataset to check pipeline function' +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' +params { + config_profile_name = 'Human BAM test profile' + config_profile_description = 'Minimal test dataset to check pipeline function' // Input data // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets // TODO nf-core: Give any required params for the test so that command line flags are not needed - input = params.pipelines_testdata_base_path + 'eager/testdata/Human/human_design_bam_eager3.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Human/human_design_bam_eager3.tsv' // Genome references - fasta = params.pipelines_testdata_base_path + 'eager/reference/Human/hs37d5_chr21-MT.fa.gz' + fasta = params.pipelines_testdata_base_path + 'eager/reference/Human/hs37d5_chr21-MT.fa.gz' // Contamination estimation contamination_estimation_angsd_mapq = 0 contamination_estimation_angsd_minq = 0 // Qualimap - snpcapture_bed = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' + snpcapture_bed = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' // TODO Reactivate sexDet and genotyping params when those steps get implemented. // //Sex Determination - sexdeterrmine_bedfile = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' + sexdeterrmine_bedfile = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' // // Genotyping - genotyping_pileupcaller_bedfile = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' - genotyping_pileupcaller_snpfile = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K_covered_in_JK2067_downsampled_s0.1.numeric_chromosomes.snp' + genotyping_pileupcaller_bedfile = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' + genotyping_pileupcaller_snpfile = params.pipelines_testdata_base_path + 'eager/reference/Human/1240K_covered_in_JK2067_downsampled_s0.1.numeric_chromosomes.snp' // BAM filtering - run_bamfiltering = true - bamfiltering_minreadlength = 30 - bamfiltering_mappingquality = 37 + run_bamfiltering = true + bamfiltering_minreadlength = 30 + bamfiltering_mappingquality = 37 // Metagenomic screening - run_metagenomics = false + run_metagenomics = false } diff --git a/conf/test_kraken2.config b/conf/test_kraken2.config index 295913d10..b976d1797 100644 --- a/conf/test_kraken2.config +++ b/conf/test_kraken2.config @@ -11,20 +11,22 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} params { - config_profile_name = 'Kraken2 test profile' - config_profile_description = 'Minimal test dataset to check the metagenomics kraken2 pipeline function' - - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' + config_profile_name = 'Kraken2 test profile' + config_profile_description = 'Minimal test dataset to check the metagenomics kraken2 pipeline function' // Input data - input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' // Genome references - fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' + fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' // Metagenomics run_metagenomics = true diff --git a/conf/test_krakenuniq.config b/conf/test_krakenuniq.config index 81ccc0c88..5b25c1d66 100644 --- a/conf/test_krakenuniq.config +++ b/conf/test_krakenuniq.config @@ -11,20 +11,23 @@ ---------------------------------------------------------------------------------------- */ -params { - config_profile_name = 'KrakenUniq test profile' - config_profile_description = 'Minimal test dataset to check the metagenomics krakenuniq pipeline function' +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' +params { + config_profile_name = 'KrakenUniq test profile' + config_profile_description = 'Minimal test dataset to check the metagenomics krakenuniq pipeline function' // Input data - input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' // Genome references - fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' + fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' // Metagenomics run_metagenomics = true diff --git a/conf/test_malt.config b/conf/test_malt.config index b1088f992..43b905cc9 100644 --- a/conf/test_malt.config +++ b/conf/test_malt.config @@ -11,20 +11,23 @@ ---------------------------------------------------------------------------------------- */ -params { - config_profile_name = 'MALT test profile' - config_profile_description = 'Minimal test dataset to check the metagenomics MALT pipeline function' +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' +params { + config_profile_name = 'MALT test profile' + config_profile_description = 'Minimal test dataset to check the metagenomics MALT pipeline function' // Input data - input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' // Genome references - fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' + fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' // Metagenomics run_metagenomics = true diff --git a/conf/test_metaphlan.config b/conf/test_metaphlan.config index 89c34a2d3..85343cb79 100644 --- a/conf/test_metaphlan.config +++ b/conf/test_metaphlan.config @@ -11,20 +11,23 @@ ---------------------------------------------------------------------------------------- */ -params { - config_profile_name = 'MetaPhlAn4 test profile' - config_profile_description = 'Minimal test dataset to check the metagenomics metaphlan4 pipeline function' +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' +params { + config_profile_name = 'MetaPhlAn4 test profile' + config_profile_description = 'Minimal test dataset to check the metagenomics metaphlan4 pipeline function' // Input data - input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_v3.tsv' // Genome references - fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' + fasta = params.pipelines_testdata_base_path + 'eager/reference/Mammoth/Mammoth_MT_Krause.fasta' // Metagenomics run_metagenomics = true diff --git a/conf/test_multiref.config b/conf/test_multiref.config index 0ef6417b6..6917a1a65 100644 --- a/conf/test_multiref.config +++ b/conf/test_multiref.config @@ -11,28 +11,29 @@ ---------------------------------------------------------------------------------------- */ -params { - config_profile_name = 'Test profile' - config_profile_description = 'Minimal test dataset to check pipeline function' +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' +params { + config_profile_name = 'Test profile' + config_profile_description = 'Minimal test dataset to check pipeline function' // Input data - input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_multilane_multilib.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Mammoth/samplesheet_multilane_multilib.tsv' // Genome references - fasta_sheet = params.pipelines_testdata_base_path + 'eager/reference/reference_sheet_multiref.csv' + fasta_sheet = params.pipelines_testdata_base_path + 'eager/reference/reference_sheet_multiref.csv' // BAM filtering - run_bamfiltering = true - bamfiltering_minreadlength = 30 - bamfiltering_mappingquality = 37 + run_bamfiltering = true + bamfiltering_minreadlength = 30 + bamfiltering_mappingquality = 37 // Metagenomics - run_metagenomics = false - - + run_metagenomics = false } diff --git a/conf/test_nothing.config b/conf/test_nothing.config index 7f8f7ae2a..976074844 100644 --- a/conf/test_nothing.config +++ b/conf/test_nothing.config @@ -10,28 +10,31 @@ ---------------------------------------------------------------------------------------- */ -params { - config_profile_name = 'Test profile' - config_profile_description = 'Minimal test dataset to check pipeline function' +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' +params { + config_profile_name = 'Test profile' + config_profile_description = 'Minimal test dataset to check pipeline function' // Input data // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets // TODO nf-core: Give any required params for the test so that command line flags are not needed - input = params.pipelines_testdata_base_path + 'eager/testdata/Human/human_design_bam_eager3.tsv' + input = params.pipelines_testdata_base_path + 'eager/testdata/Human/human_design_bam_eager3.tsv' // Genome references - fasta = params.pipelines_testdata_base_path + 'eager/reference/Human/hs37d5_chr21-MT.fa.gz' + fasta = params.pipelines_testdata_base_path + 'eager/reference/Human/hs37d5_chr21-MT.fa.gz' - skip_preprocessing = true - skip_deduplication = true - skip_qualimap = true - skip_damage_calculation = true - mapstats_skip_preseq = true + skip_preprocessing = true + skip_deduplication = true + skip_qualimap = true + skip_damage_calculation = true + mapstats_skip_preseq = true run_fastq_sharding = false run_bamfiltering = false @@ -42,5 +45,4 @@ params { run_mapdamage_rescaling = false run_pmd_filtering = false run_trim_bam = false - } From 0ac4a5e9584cbedaa5c56fb470c849054a21c278 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 14:52:59 +0200 Subject: [PATCH 12/36] Use correct plugin --- workflows/eager.nf | 616 ++++++++++++++++++++++----------------------- 1 file changed, 296 insertions(+), 320 deletions(-) diff --git a/workflows/eager.nf b/workflows/eager.nf index 51d531d00..5b949e0a5 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -4,11 +4,11 @@ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { paramsSummaryMap } from 'plugin/nf-validation' -include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' -include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' -include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_eager_pipeline' -include { addNewMetaFromAttributes } from '../subworkflows/local/utils_nfcore_eager_pipeline/main' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_eager_pipeline' +include { addNewMetaFromAttributes } from '../subworkflows/local/utils_nfcore_eager_pipeline/main' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -21,19 +21,19 @@ include { addNewMetaFromAttributes } from '../subworkflows/local/utils_nfcore_ea // // TODO rename to active: index_reference, filter_bam etc. -include { REFERENCE_INDEXING } from '../subworkflows/local/reference_indexing' -include { PREPROCESSING } from '../subworkflows/local/preprocessing' -include { MAP } from '../subworkflows/local/map' -include { FILTER_BAM } from '../subworkflows/local/bamfiltering.nf' -include { DEDUPLICATE } from '../subworkflows/local/deduplicate' -include { MANIPULATE_DAMAGE } from '../subworkflows/local/manipulate_damage' -include { METAGENOMICS_COMPLEXITYFILTER } from '../subworkflows/local/metagenomics_complexityfilter' -include { ESTIMATE_CONTAMINATION } from '../subworkflows/local/estimate_contamination' -include { CALCULATE_DAMAGE } from '../subworkflows/local/calculate_damage' -include { RUN_SEXDETERRMINE } from '../subworkflows/local/run_sex_determination' -include { MERGE_LIBRARIES } from '../subworkflows/local/merge_libraries' -include { MERGE_LIBRARIES as MERGE_LIBRARIES_GENOTYPING } from '../subworkflows/local/merge_libraries' -include { GENOTYPE } from '../subworkflows/local/genotype' +include { REFERENCE_INDEXING } from '../subworkflows/local/reference_indexing' +include { PREPROCESSING } from '../subworkflows/local/preprocessing' +include { MAP } from '../subworkflows/local/map' +include { FILTER_BAM } from '../subworkflows/local/bamfiltering.nf' +include { DEDUPLICATE } from '../subworkflows/local/deduplicate' +include { MANIPULATE_DAMAGE } from '../subworkflows/local/manipulate_damage' +include { METAGENOMICS_COMPLEXITYFILTER } from '../subworkflows/local/metagenomics_complexityfilter' +include { ESTIMATE_CONTAMINATION } from '../subworkflows/local/estimate_contamination' +include { CALCULATE_DAMAGE } from '../subworkflows/local/calculate_damage' +include { RUN_SEXDETERRMINE } from '../subworkflows/local/run_sex_determination' +include { MERGE_LIBRARIES } from '../subworkflows/local/merge_libraries' +include { MERGE_LIBRARIES as MERGE_LIBRARIES_GENOTYPING } from '../subworkflows/local/merge_libraries' +include { GENOTYPE } from '../subworkflows/local/genotype' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -48,8 +48,8 @@ include { GENOTYPE } from '../subworkflows/ include { FASTQC } from '../modules/nf-core/fastqc/main' include { MULTIQC } from '../modules/nf-core/multiqc/main' include { SAMTOOLS_COLLATEFASTQ as SAMTOOLS_CONVERT_BAM_INPUT } from '../modules/nf-core/samtools/collatefastq/main' -include { CAT_FASTQ as CAT_FASTQ_CONVERTED_BAM } from '../modules/nf-core/cat/fastq/main' -include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_BAM_INPUT } from '../modules/nf-core/samtools/index/main' +include { CAT_FASTQ as CAT_FASTQ_CONVERTED_BAM } from '../modules/nf-core/cat/fastq/main' +include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_BAM_INPUT } from '../modules/nf-core/samtools/index/main' include { PRESEQ_CCURVE } from '../modules/nf-core/preseq/ccurve/main' include { PRESEQ_LCEXTRAP } from '../modules/nf-core/preseq/lcextrap/main' include { FALCO } from '../modules/nf-core/falco/main' @@ -70,30 +70,33 @@ include { QUALIMAP_BAMQC as QUALIMAP_BAMQC_WITHBED } from '../modules */ workflow EAGER { - take: ch_samplesheet_fastqs // channel: samplesheet read in from --input - ch_samplesheet_bams + ch_samplesheet_bams main: - log.info "Schaffa, Schaffa, Genome Baua!" + log.info("Schaffa, Schaffa, Genome Baua!") ch_versions = Channel.empty() ch_multiqc_files = Channel.empty() // Reference - fasta_fn = params.fasta ? file(params.fasta, checkIfExists: true) : params.fasta_sheet ? file(params.fasta_sheet, checkIfExists: true) : [] - fasta_fai = params.fasta_fai ? file(params.fasta_fai, checkIfExists: true) : [] - fasta_dict = params.fasta_dict ? file(params.fasta_dict, checkIfExists: true) : [] + fasta_fn = params.fasta ? file(params.fasta, checkIfExists: true) : params.fasta_sheet ? file(params.fasta_sheet, checkIfExists: true) : [] + fasta_fai = params.fasta_fai ? file(params.fasta_fai, checkIfExists: true) : [] + fasta_dict = params.fasta_dict ? file(params.fasta_dict, checkIfExists: true) : [] fasta_mapperindexdir = params.fasta_mapperindexdir ? file(params.fasta_mapperindexdir, checkIfExists: true) : [] // Preprocessing - adapterlist = params.preprocessing_skipadaptertrim ? [] : params.preprocessing_adapterlist ? file(params.preprocessing_adapterlist, checkIfExists: true) : [] + adapterlist = params.preprocessing_skipadaptertrim ? [] : params.preprocessing_adapterlist ? file(params.preprocessing_adapterlist, checkIfExists: true) : [] - if ( params.preprocessing_adapterlist && !params.preprocessing_skipadaptertrim ) { - if ( params.preprocessing_tool == 'adapterremoval' && !(adapterlist.extension == 'txt') ) error "[nf-core/eager] ERROR: AdapterRemoval2 adapter list requires a `.txt` format and extension. Check input: --preprocessing_adapterlist ${params.preprocessing_adapterlist}" - if ( params.preprocessing_tool == 'fastp' && !adapterlist.extension.matches(".*(fa|fasta|fna|fas)") ) error "[nf-core/eager] ERROR: fastp adapter list requires a `.fasta` format and extension (or fa, fas, fna). Check input: --preprocessing_adapterlist ${params.preprocessing_adapterlist}" + if (params.preprocessing_adapterlist && !params.preprocessing_skipadaptertrim) { + if (params.preprocessing_tool == 'adapterremoval' && !(adapterlist.extension == 'txt')) { + error("[nf-core/eager] ERROR: AdapterRemoval2 adapter list requires a `.txt` format and extension. Check input: --preprocessing_adapterlist ${params.preprocessing_adapterlist}") + } + if (params.preprocessing_tool == 'fastp' && !adapterlist.extension.matches(".*(fa|fasta|fna|fas)")) { + error("[nf-core/eager] ERROR: fastp adapter list requires a `.fasta` format and extension (or fa, fas, fna). Check input: --preprocessing_adapterlist ${params.preprocessing_adapterlist}") + } } // @@ -102,42 +105,36 @@ workflow EAGER { if (params.convert_inputbam) { // Convert input BAMs back to FastQ with non-interleaved output. - SAMTOOLS_CONVERT_BAM_INPUT ( ch_samplesheet_bams, [ [], [] ], false ) + SAMTOOLS_CONVERT_BAM_INPUT(ch_samplesheet_bams, [[], []], false) // if BAM is single-end, pull R1 output as well as 'other' output and merge (in case collapsed reads have their R1 and R2 flags both set to 0 or 1) ch_single_end_reads = SAMTOOLS_CONVERT_BAM_INPUT.out.fastq - .filter { - meta, reads -> + .filter { meta, reads -> meta.single_end } .join(SAMTOOLS_CONVERT_BAM_INPUT.out.fastq_other) - .map { - meta, read1, fastq_other -> - [meta, [read1, fastq_other] ] + .map { meta, read1, fastq_other -> + [meta, [read1, fastq_other]] } // Put all the converted FASTQs with single-end reads back together again - CAT_FASTQ_CONVERTED_BAM( ch_single_end_reads ) + CAT_FASTQ_CONVERTED_BAM(ch_single_end_reads) //if BAM is paired-end, pull R1 and R2 outputs, discarding 'other' output and singletons - ch_paired_end_reads = SAMTOOLS_CONVERT_BAM_INPUT.out.fastq - .filter { - meta, reads -> - ! meta.single_end - } + ch_paired_end_reads = SAMTOOLS_CONVERT_BAM_INPUT.out.fastq.filter { meta, reads -> + !meta.single_end + } ch_fastqs_from_converted_bams = CAT_FASTQ_CONVERTED_BAM.out.reads .mix(ch_paired_end_reads) - // drop reference and id_index from meta - .map { - meta, reads -> - [ meta - meta.subMap('reference', 'id_index'), reads ] + .map { meta, reads -> + [meta - meta.subMap('reference', 'id_index'), reads] } // Mix the converted fastqs with the original fastqs - ch_fastqs_for_preprocessing = ch_fastqs_from_converted_bams - .mix( ch_samplesheet_fastqs ) - } else { + ch_fastqs_for_preprocessing = ch_fastqs_from_converted_bams.mix(ch_samplesheet_fastqs) + } + else { // If BAM conversion is not activated , just use the original fastqs ch_fastqs_for_preprocessing = ch_samplesheet_fastqs } @@ -146,74 +143,74 @@ workflow EAGER { // SUBWORKFLOW: Indexing of reference files // - REFERENCE_INDEXING ( fasta_fn, fasta_fai, fasta_dict, fasta_mapperindexdir ) - ch_versions = ch_versions.mix( REFERENCE_INDEXING.out.versions ) + REFERENCE_INDEXING(fasta_fn, fasta_fai, fasta_dict, fasta_mapperindexdir) + ch_versions = ch_versions.mix(REFERENCE_INDEXING.out.versions) // // MODULE: Run FastQC or Falco // - if ( params.sequencing_qc_tool == "falco" ) { - FALCO ( ch_fastqs_for_preprocessing ) - ch_versions = ch_versions.mix( FALCO.out.versions.first() ) - ch_multiqc_files = ch_multiqc_files.mix( FALCO.out.txt.collect{it[1]}.ifEmpty([]) ) - } else { - FASTQC ( ch_fastqs_for_preprocessing ) - ch_versions = ch_versions.mix( FASTQC.out.versions.first() ) - ch_multiqc_files = ch_multiqc_files.mix( FASTQC.out.zip.collect{it[1]}.ifEmpty([]) ) + if (params.sequencing_qc_tool == "falco") { + FALCO(ch_fastqs_for_preprocessing) + ch_versions = ch_versions.mix(FALCO.out.versions.first()) + ch_multiqc_files = ch_multiqc_files.mix(FALCO.out.txt.collect { it[1] }.ifEmpty([])) + } + else { + FASTQC(ch_fastqs_for_preprocessing) + ch_versions = ch_versions.mix(FASTQC.out.versions.first()) + ch_multiqc_files = ch_multiqc_files.mix(FASTQC.out.zip.collect { it[1] }.ifEmpty([])) } // // SUBWORKFLOW: Read preprocessing (clipping, merging, fastq trimming etc. ) // - if ( !params.skip_preprocessing ) { - PREPROCESSING ( ch_fastqs_for_preprocessing, adapterlist ) + if (!params.skip_preprocessing) { + PREPROCESSING(ch_fastqs_for_preprocessing, adapterlist) ch_reads_for_mapping = PREPROCESSING.out.reads - ch_versions = ch_versions.mix( PREPROCESSING.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( PREPROCESSING.out.mqc.collect{it[1]}.ifEmpty([]) ) - } else { + ch_versions = ch_versions.mix(PREPROCESSING.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(PREPROCESSING.out.mqc.collect { it[1] }.ifEmpty([])) + } + else { ch_reads_for_mapping = ch_fastqs_for_preprocessing } // // SUBWORKFLOW: Reference mapping // - ch_reference_for_mapping = REFERENCE_INDEXING.out.reference - .map{ - meta, fasta, fai, dict, index -> - [ meta, index, fasta ] - } + ch_reference_for_mapping = REFERENCE_INDEXING.out.reference.map { meta, fasta, fai, dict, index -> + [meta, index, fasta] + } - MAP ( ch_reads_for_mapping, ch_reference_for_mapping, REFERENCE_INDEXING.out.elongated_reference, REFERENCE_INDEXING.out.elongated_chr_list ) + MAP(ch_reads_for_mapping, ch_reference_for_mapping, REFERENCE_INDEXING.out.elongated_reference, REFERENCE_INDEXING.out.elongated_chr_list) - ch_versions = ch_versions.mix( MAP.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( MAP.out.mqc.collect{it[1]}.ifEmpty([]) ) + ch_versions = ch_versions.mix(MAP.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(MAP.out.mqc.collect { it[1] }.ifEmpty([])) // // MODULE: indexing of user supplied unconverted input BAMs // - if ( !params.convert_inputbam ){ - SAMTOOLS_INDEX_BAM_INPUT ( ch_samplesheet_bams ) - ch_versions = ch_versions.mix( SAMTOOLS_INDEX_BAM_INPUT.out.versions ) + if (!params.convert_inputbam) { + SAMTOOLS_INDEX_BAM_INPUT(ch_samplesheet_bams) + ch_versions = ch_versions.mix(SAMTOOLS_INDEX_BAM_INPUT.out.versions) - if ( params.fasta_largeref ) { - ch_bams_from_input = ch_samplesheet_bams.join( SAMTOOLS_INDEX_BAM_INPUT.out.csi ) - } else { - ch_bams_from_input = ch_samplesheet_bams.join( SAMTOOLS_INDEX_BAM_INPUT.out.bai ) + if (params.fasta_largeref) { + ch_bams_from_input = ch_samplesheet_bams.join(SAMTOOLS_INDEX_BAM_INPUT.out.csi) + } + else { + ch_bams_from_input = ch_samplesheet_bams.join(SAMTOOLS_INDEX_BAM_INPUT.out.bai) } // // MODULE: flagstats of user supplied input BAMs // - SAMTOOLS_FLAGSTATS_BAM_INPUT ( ch_bams_from_input ) - ch_versions = ch_versions.mix( SAMTOOLS_FLAGSTATS_BAM_INPUT.out.versions ) - ch_flagstat_input_bam = SAMTOOLS_FLAGSTATS_BAM_INPUT.out.flagstat // For endorspy - - - } else { - ch_bams_from_input = Channel.empty() + SAMTOOLS_FLAGSTATS_BAM_INPUT(ch_bams_from_input) + ch_versions = ch_versions.mix(SAMTOOLS_FLAGSTATS_BAM_INPUT.out.versions) + ch_flagstat_input_bam = SAMTOOLS_FLAGSTATS_BAM_INPUT.out.flagstat + } + else { + ch_bams_from_input = Channel.empty() ch_flagstat_input_bam = Channel.empty() } @@ -221,22 +218,22 @@ workflow EAGER { // SUBWORKFLOW: bam filtering (length, mapped/unmapped, quality etc.) // - if ( params.run_bamfiltering || params.run_metagenomics ) { + if (params.run_bamfiltering || params.run_metagenomics) { ch_mapped_for_bamfilter = MAP.out.bam - .join(MAP.out.bai) - .mix(ch_bams_from_input) + .join(MAP.out.bai) + .mix(ch_bams_from_input) - FILTER_BAM ( ch_mapped_for_bamfilter ) + FILTER_BAM(ch_mapped_for_bamfilter) ch_bamfiltered_for_deduplication = FILTER_BAM.out.genomics - ch_bamfiltered_for_metagenomics = FILTER_BAM.out.metagenomics - ch_versions = ch_versions.mix( FILTER_BAM.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( FILTER_BAM.out.mqc.collect{it[1]}.ifEmpty([]) ) - - } else { + ch_bamfiltered_for_metagenomics = FILTER_BAM.out.metagenomics + ch_versions = ch_versions.mix(FILTER_BAM.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(FILTER_BAM.out.mqc.collect { it[1] }.ifEmpty([])) + } + else { ch_bamfiltered_for_deduplication = MAP.out.bam - .join(MAP.out.bai) - .mix(ch_bams_from_input) + .join(MAP.out.bai) + .mix(ch_bams_from_input) } ch_reads_for_deduplication = ch_bamfiltered_for_deduplication @@ -245,22 +242,19 @@ workflow EAGER { // SUBWORKFLOW: genomic BAM deduplication // - ch_fasta_for_deduplication = REFERENCE_INDEXING.out.reference - .multiMap{ - meta, fasta, fai, dict, index -> - fasta: [ meta, fasta ] - fasta_fai: [ meta, fai ] - } + ch_fasta_for_deduplication = REFERENCE_INDEXING.out.reference.multiMap { meta, fasta, fai, dict, index -> + fasta: [meta, fasta] + fasta_fai: [meta, fai] + } - if ( !params.skip_deduplication ) { - DEDUPLICATE( ch_reads_for_deduplication, ch_fasta_for_deduplication.fasta, ch_fasta_for_deduplication.fasta_fai ) - ch_dedupped_bams = DEDUPLICATE.out.bam - .join( DEDUPLICATE.out.bai ) + if (!params.skip_deduplication) { + DEDUPLICATE(ch_reads_for_deduplication, ch_fasta_for_deduplication.fasta, ch_fasta_for_deduplication.fasta_fai) + ch_dedupped_bams = DEDUPLICATE.out.bam.join(DEDUPLICATE.out.bai) ch_dedupped_flagstat = DEDUPLICATE.out.flagstat - ch_versions = ch_versions.mix( DEDUPLICATE.out.versions ) - - } else { - ch_dedupped_bams = ch_reads_for_deduplication + ch_versions = ch_versions.mix(DEDUPLICATE.out.versions) + } + else { + ch_dedupped_bams = ch_reads_for_deduplication ch_dedupped_flagstat = Channel.empty() } @@ -268,96 +262,88 @@ workflow EAGER { // SUBWORKFLOW: Merge libraries per sample // - MERGE_LIBRARIES ( ch_dedupped_bams ) - ch_versions = ch_versions.mix( MERGE_LIBRARIES.out.versions ) + MERGE_LIBRARIES(ch_dedupped_bams) + ch_versions = ch_versions.mix(MERGE_LIBRARIES.out.versions) ch_merged_dedup_bams = MERGE_LIBRARIES.out.bam_bai - ch_multiqc_files = ch_multiqc_files.mix( MERGE_LIBRARIES.out.mqc.collect{it[1]}.ifEmpty([]) ) + ch_multiqc_files = ch_multiqc_files.mix(MERGE_LIBRARIES.out.mqc.collect { it[1] }.ifEmpty([])) // // MODULE QUALIMAP // - if ( !params.skip_qualimap ) { - ch_snp_capture_bed = REFERENCE_INDEXING.out.snp_capture_bed - .map{ - addNewMetaFromAttributes( it, "id" , "reference" , false ) - } + if (!params.skip_qualimap) { + ch_snp_capture_bed = REFERENCE_INDEXING.out.snp_capture_bed.map { + addNewMetaFromAttributes(it, "id", "reference", false) + } ch_qualimap_input = ch_merged_dedup_bams - .map { - meta, bam, bai -> - [ meta, bam ] + .map { meta, bam, bai -> + [meta, bam] } .map { - addNewMetaFromAttributes( it, "reference" , "reference" , false ) + addNewMetaFromAttributes(it, "reference", "reference", false) } .combine( - by: 0, - ch_snp_capture_bed + ch_snp_capture_bed, + by: 0 ) - .branch { - ignore_meta, meta, bam, meta2, snp_capture_bed -> + .branch { ignore_meta, meta, bam, meta2, snp_capture_bed -> withbed: snp_capture_bed != "" nobed: true } - ch_qualimap_input_with = ch_qualimap_input.withbed - .multiMap{ - ignore_meta, meta, bam, meta2, snp_capture_bed -> - bam: [ meta, bam ] - snp_capture_bed: [ snp_capture_bed ] - } + ch_qualimap_input_with = ch_qualimap_input.withbed.multiMap { ignore_meta, meta, bam, meta2, snp_capture_bed -> + bam: [meta, bam] + snp_capture_bed: [snp_capture_bed] + } - QUALIMAP_BAMQC_WITHBED( ch_qualimap_input_with.bam, ch_qualimap_input_with.snp_capture_bed ) - ch_qualimap_input_without = ch_qualimap_input.nobed - .map{ - ignore_meta, meta, bam, meta2, snp_capture_bed -> - [ meta, bam ] - } + QUALIMAP_BAMQC_WITHBED(ch_qualimap_input_with.bam, ch_qualimap_input_with.snp_capture_bed) + ch_qualimap_input_without = ch_qualimap_input.nobed.map { ignore_meta, meta, bam, meta2, snp_capture_bed -> + [meta, bam] + } - QUALIMAP_BAMQC_NOBED( ch_qualimap_input_without, [] ) - ch_qualimap_output = QUALIMAP_BAMQC_WITHBED.out.results.mix( QUALIMAP_BAMQC_NOBED.out.results ) - ch_versions = ch_versions.mix( QUALIMAP_BAMQC_NOBED.out.versions ).mix( QUALIMAP_BAMQC_WITHBED.out.versions ) + QUALIMAP_BAMQC_NOBED(ch_qualimap_input_without, []) + ch_qualimap_output = QUALIMAP_BAMQC_WITHBED.out.results.mix(QUALIMAP_BAMQC_NOBED.out.results) + ch_versions = ch_versions.mix(QUALIMAP_BAMQC_NOBED.out.versions).mix(QUALIMAP_BAMQC_WITHBED.out.versions) } // // MODULE: remove reads mapping to the host from the raw fastq // - if ( params.run_host_removal ) { + if (params.run_host_removal) { // Preparing bam channel for host removal to be combined with the input fastq channel // The bam channel consist of [meta, bam, bai] and in the meta we have in addition 'single_end' always set as TRUE and 'reference' set // To be able to join it with fastq channel, we need to remove them from the meta (done in map) and stored in new_meta - ch_bam_for_host_removal= MAP.out.bam.join(MAP.out.bai) - .map{ - meta, bam, bai -> - new_meta = meta.clone().findAll{ it.key !in [ 'single_end', 'reference' ] } - [ new_meta, meta, bam, bai ] - } + ch_bam_for_host_removal = MAP.out.bam + .join(MAP.out.bai) + .map { meta, bam, bai -> + new_meta = meta.clone().findAll { it.key !in ['single_end', 'reference'] } + [new_meta, meta, bam, bai] + } // Preparing fastq channel for host removal to be combined with the bam channel // The meta of the fastq channel contains additional fields when compared to the meta from the bam channel: lane, colour_chemistry, // and not necessarily matching single_end. Those fields are dropped of the meta in the map and stored in new_meta - ch_fastqs_for_host_removal= ch_fastqs_for_preprocessing.map{ - meta, fastqs -> - new_meta = meta.clone().findAll{ it.key !in [ 'lane', 'colour_chemistry', 'single_end' ] } - [ new_meta, meta, fastqs ] - } + ch_fastqs_for_host_removal = ch_fastqs_for_preprocessing.map { meta, fastqs -> + new_meta = meta.clone().findAll { it.key !in ['lane', 'colour_chemistry', 'single_end'] } + [new_meta, meta, fastqs] + } // We join the bam and fastq channel with now matching metas (new_meta) referred as meta_join // and remove the meta_join from the final channel, keeping the original metas for the bam and the fastqs - ch_input_for_host_removal = ch_bam_for_host_removal.join(ch_fastqs_for_host_removal) - .map{ - meta_join, meta_bam, bam, bai, meta_fastq, fastqs -> - [ meta_bam, bam, bai, meta_fastq, fastqs] - } + ch_input_for_host_removal = ch_bam_for_host_removal + .join(ch_fastqs_for_host_removal) + .map { meta_join, meta_bam, bam, bai, meta_fastq, fastqs -> + [meta_bam, bam, bai, meta_fastq, fastqs] + } - HOST_REMOVAL ( ch_input_for_host_removal ) + HOST_REMOVAL(ch_input_for_host_removal) - ch_versions = ch_versions.mix( HOST_REMOVAL.out.versions ) + ch_versions = ch_versions.mix(HOST_REMOVAL.out.versions) } // // Section: Metagenomics // - if ( params.run_metagenomics ) { + if (params.run_metagenomics) { ch_database = Channel.fromPath(params.metagenomics_profiling_database) @@ -365,94 +351,93 @@ workflow EAGER { ch_tax_list = Channel.empty() ch_ncbi_dir = Channel.empty() - if ( params.metagenomics_run_postprocessing && params.metagenomics_profiling_tool == 'malt' ){ - ch_tax_list = Channel.fromPath(params.metagenomics_maltextract_taxonlist, checkIfExists:true) - ch_ncbi_dir = Channel.fromPath(params.metagenomics_maltextract_ncbidir, checkIfExists:true) + if (params.metagenomics_run_postprocessing && params.metagenomics_profiling_tool == 'malt') { + ch_tax_list = Channel.fromPath(params.metagenomics_maltextract_taxonlist, checkIfExists: true) + ch_ncbi_dir = Channel.fromPath(params.metagenomics_maltextract_ncbidir, checkIfExists: true) } - METAGENOMICS ( ch_bamfiltered_for_metagenomics, ch_database, ch_tax_list, ch_ncbi_dir ) - ch_versions = ch_versions.mix( METAGENOMICS.out.versions.first() ) - ch_multiqc_files = ch_multiqc_files.mix( METAGENOMICS.out.ch_multiqc_files ) + METAGENOMICS(ch_bamfiltered_for_metagenomics, ch_database, ch_tax_list, ch_ncbi_dir) + ch_versions = ch_versions.mix(METAGENOMICS.out.versions.first()) + ch_multiqc_files = ch_multiqc_files.mix(METAGENOMICS.out.ch_multiqc_files) } // // MODULE: MTNUCRATIO // - if ( params.run_mtnucratio ) { - ch_mito_header = REFERENCE_INDEXING.out.mitochondrion_header - .map{ - addNewMetaFromAttributes( it, "id" , "reference" , false ) - } + if (params.run_mtnucratio) { + ch_mito_header = REFERENCE_INDEXING.out.mitochondrion_header.map { + addNewMetaFromAttributes(it, "id", "reference", false) + } mtnucratio_input = ch_dedupped_bams .map { - addNewMetaFromAttributes( it, "reference" , "reference" , false ) + addNewMetaFromAttributes(it, "reference", "reference", false) } .combine( - by: 0, - ch_mito_header + ch_mito_header, + by: 0 ) - .multiMap{ - ignore_meta, meta, bam, bai, meta2, mito_header -> - bam: [ meta, bam ] - mito_header: [ meta2, mito_header ] + .multiMap { ignore_meta, meta, bam, bai, meta2, mito_header -> + bam: [meta, bam] + mito_header: [meta2, mito_header] } - MTNUCRATIO( mtnucratio_input.bam, mtnucratio_input.mito_header.map{ it[1] } ) - ch_multiqc_files = ch_multiqc_files.mix(MTNUCRATIO.out.mtnucratio.collect{it[1]}.ifEmpty([])) - ch_versions = ch_versions.mix( MTNUCRATIO.out.versions ) + MTNUCRATIO(mtnucratio_input.bam, mtnucratio_input.mito_header.map { it[1] }) + ch_multiqc_files = ch_multiqc_files.mix(MTNUCRATIO.out.mtnucratio.collect { it[1] }.ifEmpty([])) + ch_versions = ch_versions.mix(MTNUCRATIO.out.versions) } // // MODULE: ENDORSPY (raw, filtered, deduplicated) // - ch_flagstat_for_endorspy_raw = MAP.out.flagstat - .mix( ch_flagstat_input_bam ) + ch_flagstat_for_endorspy_raw = MAP.out.flagstat.mix(ch_flagstat_input_bam) - if ( params.run_bamfiltering & !params.skip_deduplication ) { + if (params.run_bamfiltering & !params.skip_deduplication) { ch_for_endorspy = ch_flagstat_for_endorspy_raw - .join (FILTER_BAM.out.flagstat) - .join (DEDUPLICATE.out.flagstat) - } else if ( params.run_bamfiltering & params.skip_deduplication ) { - ch_for_endorspy = ch_flagstat_for_endorspy_raw - .join (FILTER_BAM.out.flagstat) - .map{ - meta, flags_raw, flags_filtered -> - [ meta, flags_raw, flags_filtered, [] ] - } - } else if ( !params.run_bamfiltering & !params.skip_deduplication) { + .join(FILTER_BAM.out.flagstat) + .join(DEDUPLICATE.out.flagstat) + } + else if (params.run_bamfiltering & params.skip_deduplication) { ch_for_endorspy = ch_flagstat_for_endorspy_raw - .join (DEDUPLICATE.out.flagstat) - . map{ - meta, flags_raw, flags_dedup -> - [ meta, flags_raw, [], flags_dedup ] - } - } else { + .join(FILTER_BAM.out.flagstat) + .map { meta, flags_raw, flags_filtered -> + [meta, flags_raw, flags_filtered, []] + } + } + else if (!params.run_bamfiltering & !params.skip_deduplication) { ch_for_endorspy = ch_flagstat_for_endorspy_raw - .map { - meta, flags_raw -> - [ meta, flags_raw, [], [] ] - } + .join(DEDUPLICATE.out.flagstat) + .map { meta, flags_raw, flags_dedup -> + [meta, flags_raw, [], flags_dedup] + } + } + else { + ch_for_endorspy = ch_flagstat_for_endorspy_raw.map { meta, flags_raw -> + [meta, flags_raw, [], []] + } } - ENDORSPY ( ch_for_endorspy ) + ENDORSPY(ch_for_endorspy) - ch_versions = ch_versions.mix( ENDORSPY.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( ENDORSPY.out.json.collect{it[1]}.ifEmpty([]) ) + ch_versions = ch_versions.mix(ENDORSPY.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(ENDORSPY.out.json.collect { it[1] }.ifEmpty([])) // // MODULE: PreSeq // - if ( !params.mapstats_skip_preseq && params.mapstats_preseq_mode == 'c_curve') { - PRESEQ_CCURVE(ch_reads_for_deduplication.map{[it[0],it[1]]}) - ch_multiqc_files = ch_multiqc_files.mix(PRESEQ_CCURVE.out.c_curve.collect{it[1]}.ifEmpty([])) - ch_versions = ch_versions.mix( PRESEQ_CCURVE.out.versions ) - } else ( !params.mapstats_skip_preseq && params.mapstats_preseq_mode == 'lc_extrap') { - PRESEQ_LCEXTRAP(ch_reads_for_deduplication.map{[it[0],it[1]]}) - ch_multiqc_files = ch_multiqc_files.mix(PRESEQ_LCEXTRAP.out.lc_extrap.collect{it[1]}.ifEmpty([])) - ch_versions = ch_versions.mix( PRESEQ_LCEXTRAP.out.versions ) + if (!params.mapstats_skip_preseq && params.mapstats_preseq_mode == 'c_curve') { + PRESEQ_CCURVE(ch_reads_for_deduplication.map { [it[0], it[1]] }) + ch_multiqc_files = ch_multiqc_files.mix(PRESEQ_CCURVE.out.c_curve.collect { it[1] }.ifEmpty([])) + ch_versions = ch_versions.mix(PRESEQ_CCURVE.out.versions) + } + else { + (!params.mapstats_skip_preseq && params.mapstats_preseq_mode == 'lc_extrap').call { + PRESEQ_LCEXTRAP(ch_reads_for_deduplication.map { [it[0], it[1]] }) + ch_multiqc_files = ch_multiqc_files.mix(PRESEQ_LCEXTRAP.out.lc_extrap.collect { it[1] }.ifEmpty([])) + ch_versions = ch_versions.mix(PRESEQ_LCEXTRAP.out.versions) + } } @@ -460,108 +445,101 @@ workflow EAGER { // MODULE: Bedtools coverage // - if ( params.run_bedtools_coverage ) { + if (params.run_bedtools_coverage) { - ch_bedtools_feature = REFERENCE_INDEXING.out.bedtools_feature - .map{ - addNewMetaFromAttributes( it, "id" , "reference" , false ) - } + ch_bedtools_feature = REFERENCE_INDEXING.out.bedtools_feature.map { + addNewMetaFromAttributes(it, "id", "reference", false) + } ch_bedtools_prep = ch_merged_dedup_bams - .map { - addNewMetaFromAttributes( it, "reference" , "reference" , false ) - } - .combine( - by: 0, - ch_bedtools_feature - ) - .map{ - ignore_meta, meta, bam, bai, meta2, bedtools_feature -> - [ meta, bedtools_feature, bam, bai ] - } - .branch{ - meta, bedtools_feature, bam, bai -> - withfeature: bedtools_feature != "" - nobed: true - } + .map { + addNewMetaFromAttributes(it, "reference", "reference", false) + } + .combine( + ch_bedtools_feature, + by: 0 + ) + .map { ignore_meta, meta, bam, bai, meta2, bedtools_feature -> + [meta, bedtools_feature, bam, bai] + } + .branch { meta, bedtools_feature, bam, bai -> + withfeature: bedtools_feature != "" + nobed: true + } // Running samtools view to get header - ch_bedtools_input = ch_bedtools_prep.withfeature - .multiMap{ - meta, bedtools_feature, bam, bai -> - bam: [ meta, bam, bai ] - withfeature: [ meta, bedtools_feature, bam ] - } + ch_bedtools_input = ch_bedtools_prep.withfeature.multiMap { meta, bedtools_feature, bam, bai -> + bam: [meta, bam, bai] + withfeature: [meta, bedtools_feature, bam] + } - SAMTOOLS_VIEW_GENOME( ch_bedtools_input.bam ) + SAMTOOLS_VIEW_GENOME(ch_bedtools_input.bam) ch_genome_for_bedtools = SAMTOOLS_VIEW_GENOME.out.genome BEDTOOLS_COVERAGE_DEPTH(ch_bedtools_input.withfeature, ch_genome_for_bedtools) - ch_versions = ch_versions.mix( SAMTOOLS_VIEW_GENOME.out.versions ) + ch_versions = ch_versions.mix(SAMTOOLS_VIEW_GENOME.out.versions) //ch_versions = ch_versions.mix( BEDTOOLS_COVERAGE_BREADTH.out.versions ) - ch_versions = ch_versions.mix( BEDTOOLS_COVERAGE_DEPTH.out.versions ) + ch_versions = ch_versions.mix(BEDTOOLS_COVERAGE_DEPTH.out.versions) } // // SUBWORKFLOW: Calculate Damage // - ch_fasta_for_damagecalculation = REFERENCE_INDEXING.out.reference - .multiMap{ - meta, fasta, fai, dict, index -> - fasta: [ meta, fasta ] - fasta_fai: [ meta, fai ] - } - - if ( !params.skip_damagecalculation ) { - CALCULATE_DAMAGE( ch_dedupped_bams, ch_fasta_for_damagecalculation.fasta, ch_fasta_for_damagecalculation.fasta_fai ) - ch_versions = ch_versions.mix( CALCULATE_DAMAGE.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix(CALCULATE_DAMAGE.out.mqc.collect{it[1]}.ifEmpty([])) + ch_fasta_for_damagecalculation = REFERENCE_INDEXING.out.reference.multiMap { meta, fasta, fai, dict, index -> + fasta: [meta, fasta] + fasta_fai: [meta, fai] + } + if (!params.skip_damagecalculation) { + CALCULATE_DAMAGE(ch_dedupped_bams, ch_fasta_for_damagecalculation.fasta, ch_fasta_for_damagecalculation.fasta_fai) + ch_versions = ch_versions.mix(CALCULATE_DAMAGE.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(CALCULATE_DAMAGE.out.mqc.collect { it[1] }.ifEmpty([])) } // // SUBWORKFLOW: Run Sex Determination // - if ( params.run_sexdeterrmine ) { + if (params.run_sexdeterrmine) { ch_sexdeterrmine_input = ch_merged_dedup_bams - RUN_SEXDETERRMINE(ch_sexdeterrmine_input, REFERENCE_INDEXING.out.sexdeterrmine_bed ) - ch_versions = ch_versions.mix( RUN_SEXDETERRMINE.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( RUN_SEXDETERRMINE.out.mqc.collect{it[1]}.ifEmpty([]) ) + RUN_SEXDETERRMINE(ch_sexdeterrmine_input, REFERENCE_INDEXING.out.sexdeterrmine_bed) + ch_versions = ch_versions.mix(RUN_SEXDETERRMINE.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(RUN_SEXDETERRMINE.out.mqc.collect { it[1] }.ifEmpty([])) } // // SUBWORKFLOW: Contamination estimation // - if ( params.run_contamination_estimation_angsd ) { + if (params.run_contamination_estimation_angsd) { contamination_input = ch_dedupped_bams - ESTIMATE_CONTAMINATION( contamination_input, REFERENCE_INDEXING.out.hapmap ) - ch_versions = ch_versions.mix( ESTIMATE_CONTAMINATION.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( ESTIMATE_CONTAMINATION.out.mqc.collect{it[1]}.ifEmpty([]) ) + ESTIMATE_CONTAMINATION(contamination_input, REFERENCE_INDEXING.out.hapmap) + ch_versions = ch_versions.mix(ESTIMATE_CONTAMINATION.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(ESTIMATE_CONTAMINATION.out.mqc.collect { it[1] }.ifEmpty([])) } // // SUBWORKFLOW: aDNA Damage Manipulation // - if ( params.run_mapdamage_rescaling || params.run_pmd_filtering || params.run_trim_bam ) { - MANIPULATE_DAMAGE( ch_dedupped_bams, ch_fasta_for_deduplication.fasta, REFERENCE_INDEXING.out.pmd_masking ) - ch_multiqc_files = ch_multiqc_files.mix( MANIPULATE_DAMAGE.out.flagstat.collect{it[1]}.ifEmpty([]) ) - ch_versions = ch_versions.mix( MANIPULATE_DAMAGE.out.versions ) + if (params.run_mapdamage_rescaling || params.run_pmd_filtering || params.run_trim_bam) { + MANIPULATE_DAMAGE(ch_dedupped_bams, ch_fasta_for_deduplication.fasta, REFERENCE_INDEXING.out.pmd_masking) + ch_multiqc_files = ch_multiqc_files.mix(MANIPULATE_DAMAGE.out.flagstat.collect { it[1] }.ifEmpty([])) + ch_versions = ch_versions.mix(MANIPULATE_DAMAGE.out.versions) ch_bams_for_library_merge = params.genotyping_source == 'rescaled' ? MANIPULATE_DAMAGE.out.rescaled : params.genotyping_source == 'pmd' ? MANIPULATE_DAMAGE.out.filtered : params.genotyping_source == 'trimmed' ? MANIPULATE_DAMAGE.out.trimmed : ch_merged_dedup_bams - // SUBWORKFLOW: merge libraries for genotyping - MERGE_LIBRARIES_GENOTYPING ( ch_bams_for_library_merge ) - ch_versions = ch_versions.mix( MERGE_LIBRARIES_GENOTYPING.out.versions ) + // SUBWORKFLOW: merge libraries for genotyping + MERGE_LIBRARIES_GENOTYPING(ch_bams_for_library_merge) + ch_versions = ch_versions.mix(MERGE_LIBRARIES_GENOTYPING.out.versions) ch_bams_for_genotyping = MERGE_LIBRARIES_GENOTYPING.out.bam_bai - ch_multiqc_files = ch_multiqc_files.mix( MERGE_LIBRARIES_GENOTYPING.out.mqc.collect{it[1]}.ifEmpty([]) ) - } else { + ch_multiqc_files = ch_multiqc_files.mix(MERGE_LIBRARIES_GENOTYPING.out.mqc.collect { it[1] }.ifEmpty([])) + } + else { ch_bams_for_genotyping = ch_merged_dedup_bams } @@ -569,22 +547,19 @@ workflow EAGER { // SUBWORKFLOW: Genotyping // - if ( params.run_genotyping ) { - ch_reference_for_genotyping = REFERENCE_INDEXING.out.reference - // Remove unnecessary files from the reference channel, so SWF doesn't break with each change to reference channel. - .map { - meta, fasta, fai, dict, mapindex -> - [ meta, fasta, fai, dict ] - } + if (params.run_genotyping) { + ch_reference_for_genotyping = REFERENCE_INDEXING.out.reference.map { meta, fasta, fai, dict, mapindex -> + [meta, fasta, fai, dict] + } GENOTYPE( - ch_bams_for_genotyping, // [ [meta] , bam, bai ] - ch_reference_for_genotyping, // [ [ref_meta] , fasta, fai, dict ] - REFERENCE_INDEXING.out.pileupcaller_bed_snp.ifEmpty([[],[],[]]), // [ [ref_meta] , bed, snp ] - REFERENCE_INDEXING.out.dbsnp.ifEmpty([[],[]]) // [ [ref_meta] , dbsnp ] - ) + ch_bams_for_genotyping, + ch_reference_for_genotyping, + REFERENCE_INDEXING.out.pileupcaller_bed_snp.ifEmpty([[], [], []]), + REFERENCE_INDEXING.out.dbsnp.ifEmpty([[], []]) + ) - ch_versions = ch_versions.mix( GENOTYPE.out.versions ) - ch_multiqc_files = ch_multiqc_files.mix( GENOTYPE.out.mqc.collect{it[1]}.ifEmpty([]) ) + ch_versions = ch_versions.mix(GENOTYPE.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(GENOTYPE.out.mqc.collect { it[1] }.ifEmpty([])) } // @@ -593,34 +568,41 @@ workflow EAGER { softwareVersionsToYAML(ch_versions) .collectFile( storeDir: "${params.outdir}/pipeline_info", - name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', + name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', sort: true, newLine: true - ).set { ch_collated_versions } + ) + .set { ch_collated_versions } // // MODULE: MultiQC // - ch_multiqc_config = Channel.fromPath( - "$projectDir/assets/multiqc_config.yml", checkIfExists: true) - ch_multiqc_custom_config = params.multiqc_config ? - Channel.fromPath(params.multiqc_config, checkIfExists: true) : - Channel.empty() - ch_multiqc_logo = params.multiqc_logo ? - Channel.fromPath(params.multiqc_logo, checkIfExists: true) : - Channel.empty() - - summary_params = paramsSummaryMap( - workflow, parameters_schema: "nextflow_schema.json") + ch_multiqc_config = Channel.fromPath( + "${projectDir}/assets/multiqc_config.yml", + checkIfExists: true + ) + ch_multiqc_custom_config = params.multiqc_config + ? Channel.fromPath(params.multiqc_config, checkIfExists: true) + : Channel.empty() + ch_multiqc_logo = params.multiqc_logo + ? Channel.fromPath(params.multiqc_logo, checkIfExists: true) + : Channel.empty() + + summary_params = paramsSummaryMap( + workflow, + parameters_schema: "nextflow_schema.json" + ) ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) ch_multiqc_files = ch_multiqc_files.mix( - ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) - ch_multiqc_custom_methods_description = params.multiqc_methods_description ? - file(params.multiqc_methods_description, checkIfExists: true) : - file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) - ch_methods_description = Channel.value( - methodsDescriptionText(ch_multiqc_custom_methods_description)) + ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml') + ) + ch_multiqc_custom_methods_description = params.multiqc_methods_description + ? file(params.multiqc_methods_description, checkIfExists: true) + : file("${projectDir}/assets/methods_description_template.yml", checkIfExists: true) + ch_methods_description = Channel.value( + methodsDescriptionText(ch_multiqc_custom_methods_description) + ) ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) ch_multiqc_files = ch_multiqc_files.mix( @@ -630,11 +612,11 @@ workflow EAGER { ) ) - if ( !params.skip_qualimap ) { - ch_multiqc_files = ch_multiqc_files.mix( ch_qualimap_output.collect{it[1]}.ifEmpty([]) ) + if (!params.skip_qualimap) { + ch_multiqc_files = ch_multiqc_files.mix(ch_qualimap_output.collect { it[1] }.ifEmpty([])) } - MULTIQC ( + MULTIQC( ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), @@ -643,13 +625,7 @@ workflow EAGER { [] ) - emit:multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html - versions = ch_versions // channel: [ path(versions.yml) ] - + emit: + multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + versions = ch_versions // channel: [ path(versions.yml) ] } - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - THE END -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ From bdbe5371b18f9150217e83772f28d6757f92a6ae Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 14:53:05 +0200 Subject: [PATCH 13/36] Migrate to nf-validation --- assets/schema_fasta.json | 15 +++++++++------ assets/schema_input.json | 22 +++++++++++++--------- 2 files changed, 22 insertions(+), 15 deletions(-) diff --git a/assets/schema_fasta.json b/assets/schema_fasta.json index 54e00de8e..c6a13f8f6 100644 --- a/assets/schema_fasta.json +++ b/assets/schema_fasta.json @@ -11,7 +11,6 @@ "type": "string", "pattern": "^\\S+$", "meta": ["id"], - "unique": true, "errorMessage": "Reference name must be provided and cannot contain spaces." }, "fasta": { @@ -19,7 +18,6 @@ "format": "file-path", "pattern": "^\\S+\\.f(na|asta|a|as)(\\.gz)?$", "exists": true, - "unique": true, "errorMessage": "Fasta files for the mapping reference must be provided with file extensions '.fasta', '.fa', '.fas', '.fna', '.fasta.gz','.fa.gz','.fas.gz', '.fna.gz' and cannot contain any spaces." }, "fai": { @@ -79,7 +77,6 @@ "format": "file-path", "pattern": "^\\S+\\.bed(\\.gz)?$", "exists": true, - "dependentRequired": ["pileupcaller_snpfile"], "errorMessage": "SNP capture bed files for pileupcaller must not contain any spaces, have file extensions '.bed' or '.bed.gz' and be provided alongside a pileupcall_bedfile." }, "pileupcaller_snpfile": { @@ -87,7 +84,6 @@ "format": "file-path", "pattern": "^\\S+\\.snp$", "exists": true, - "dependentRequired": ["pileupcaller_bedfile"], "errorMessage": "SNP panel files for pileupcaller must not contain any spaces, have file extension '.snp' and be provided alongside a pileupcaller_snpfile." }, "hapmap_file": { @@ -138,6 +134,13 @@ "errorMessage": "SNP annotation files for GATK must not contain any spaces and have file extension '.vcf'." } }, - "required": ["reference_name", "fasta"] - } + "required": ["reference_name", "fasta"], + "dependentRequired": { + "pileupcaller_snpfile": ["pileupcaller_bedfile"], + "pileupcaller_bedfile": ["pileupcaller_snpfile"], + "bam": ["bam_reference_id"], + "bam_reference_id": ["bam"] + } + }, + "allOf": [{ "uniqueEntries": "reference_name" }, { "uniqueEntries": "fasta" }] } diff --git a/assets/schema_input.json b/assets/schema_input.json index 7956b0f09..673a694a2 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -21,7 +21,6 @@ }, "lane": { "type": "integer", - "unique": ["library_id"], "meta": ["lane"], "errorMessage": "Sequencing lane number must be provided and specified as an integer. If no lane information, specify 0." }, @@ -54,7 +53,6 @@ "format": "file-path", "pattern": "^\\S+\\.f(ast)?q\\.gz$", "exists": true, - "unique": true, "errorMessage": "FastQ file for reads 1 cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'." }, "r2": { @@ -62,8 +60,6 @@ "format": "file-path", "pattern": "^\\S+\\.f(ast)?q\\.gz$", "exists": true, - "unique": true, - "dependentRequired": ["r1"], "errorMessage": "FastQ file for reads 2 require files for reads 1, cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'." }, "bam": { @@ -71,14 +67,11 @@ "format": "file-path", "pattern": "^\\S+\\.bam$", "exists": true, - "unique": true, - "dependentRequired": ["bam_reference_id"], "errorMessage": "BAM files cannot contain any spaces and must have extension '.bam'." }, "bam_reference_id": { "type": "string", "meta": ["bam_reference_id"], - "dependentRequired": ["bam"], "errorMessage": "A BAM reference ID (corresponding to what is supplied to `--fasta`) must always be provided when providing a BAM file." } }, @@ -98,6 +91,17 @@ { "required": ["bam"] } - ] - } + ], + "dependentRequired": { + "r2": ["r1"], + "bam": ["bam_reference_id"], + "bam_reference_id": ["bam"] + } + }, + "allOf": [ + { "uniqueEntries": ["lane", "library_id"] }, + { "uniqueEntries": "r1" }, + { "uniqueEntries": "r2" }, + { "uniqueEntries": "bam" } + ] } From 73180868cee49864a547b68905bc07624ab2f1e0 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 14:54:14 +0200 Subject: [PATCH 14/36] Linting --- .github/workflows/ci.yml | 1 - 1 file changed, 1 deletion(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 92e1b592b..e0a892ac8 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -92,4 +92,3 @@ jobs: - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} --outdir ./results ${{ matrix.PARAMS }} - From 30f5c7ff6be7b50d8d1757fe70f6085b70cbc773 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 14:56:27 +0200 Subject: [PATCH 15/36] Fix linting --- workflows/eager.nf | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/eager.nf b/workflows/eager.nf index 5b949e0a5..64bdd8f9a 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -71,8 +71,8 @@ include { QUALIMAP_BAMQC as QUALIMAP_BAMQC_WITHBED } from '../modules workflow EAGER { take: - ch_samplesheet_fastqs // channel: samplesheet read in from --input - ch_samplesheet_bams + ch_samplesheet_fastqs // channel: samplesheet FASTQ entries read in from --input + ch_samplesheet_bams // channel: samplesheet BAM entries read in from --input main: From ce287d9a584be849f5969df1a353dfde5238cc6d Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 16:07:27 +0200 Subject: [PATCH 16/36] Try hack around our PARAMS until moved to confirms --- .github/workflows/ci.yml | 18 +++++++++--------- 1 file changed, 9 insertions(+), 9 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index e0a892ac8..682d9e7f3 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -44,14 +44,14 @@ jobs: - isMaster: false profile: "singularity" PARAMS: - - "-profile test,docker --preprocessing_tool fastp --preprocessing_adapterlist 'https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta'" - - "-profile test,docker --preprocessing_tool adapterremoval --preprocessing_adapterlist 'https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/adapterremoval/adapterremoval_adapterlist.txt' --sequencing_qc_tool falco --run_genotyping --genotyping_tool 'freebayes' --genotyping_source 'raw'" - - "-profile test,docker --mapping_tool bwamem --run_mapdamage_rescaling --run_pmd_filtering --run_trim_bam --run_genotyping --genotyping_tool 'ug' --genotyping_source 'trimmed'" - - "-profile test,docker --mapping_tool bowtie2 --damagecalculation_tool mapdamage --damagecalculation_mapdamage_downsample 100 --run_genotyping --genotyping_tool 'hc' --genotyping_source 'raw'" - - "-profile test,docker --mapping_tool circularmapper --skip_preprocessing --convert_inputbam --fasta_circular_target 'NC_007596.2' --fasta_circularmapper_elongationfactor 500" - - "-profile test_humanbam,docker --run_mtnucratio --run_contamination_estimation_angsd --snpcapture_bed 'https://raw.githubusercontent.com/nf-core/test-datasets/eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' --run_genotyping --genotyping_tool 'pileupcaller' --genotyping_source 'raw'" - - "-profile test_humanbam,docker --run_sexdeterrmine --run_genotyping --genotyping_tool 'angsd' --genotyping_source 'raw'" - - "-profile test_multiref,docker" ## TODO add damage manipulation here instead once it goes multiref + - " --preprocessing_tool fastp --preprocessing_adapterlist 'https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta'" + - " --preprocessing_tool adapterremoval --preprocessing_adapterlist 'https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/adapterremoval/adapterremoval_adapterlist.txt' --sequencing_qc_tool falco --run_genotyping --genotyping_tool 'freebayes' --genotyping_source 'raw'" + - " --mapping_tool bwamem --run_mapdamage_rescaling --run_pmd_filtering --run_trim_bam --run_genotyping --genotyping_tool 'ug' --genotyping_source 'trimmed'" + - " --mapping_tool bowtie2 --damagecalculation_tool mapdamage --damagecalculation_mapdamage_downsample 100 --run_genotyping --genotyping_tool 'hc' --genotyping_source 'raw'" + - " --mapping_tool circularmapper --skip_preprocessing --convert_inputbam --fasta_circular_target 'NC_007596.2' --fasta_circularmapper_elongationfactor 500" + - "_humanbam --run_mtnucratio --run_contamination_estimation_angsd --snpcapture_bed 'https://raw.githubusercontent.com/nf-core/test-datasets/eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz' --run_genotyping --genotyping_tool 'pileupcaller' --genotyping_source 'raw'" + - "_humanbam --run_sexdeterrmine --run_genotyping --genotyping_tool 'angsd' --genotyping_source 'raw'" + - "_multiref" ## TODO add damage manipulation here instead once it goes multiref steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 @@ -91,4 +91,4 @@ jobs: - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | - nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} --outdir ./results ${{ matrix.PARAMS }} + nextflow run ${GITHUB_WORKSPACE} -profile ${{matrix.profile}},${{ matrix.test_name }}${{ matrix.PARAMS }} --outdir ./results From 621c2ba84cbf3609b69593751248cd1904ee8be4 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 25 Oct 2024 16:14:39 +0200 Subject: [PATCH 17/36] Use correct json schema for shcema_fasta --- assets/schema_fasta.json | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/assets/schema_fasta.json b/assets/schema_fasta.json index c6a13f8f6..b921e13f3 100644 --- a/assets/schema_fasta.json +++ b/assets/schema_fasta.json @@ -1,8 +1,8 @@ { - "$schema": "http://json-schema.org/draft-07/schema", - "$id": "https://raw.githubusercontent.com/nf-core/eager/master/assets/schema_fasta.json", - "title": "nf-core/eager pipeline - params.fasta schema", - "description": "Schema for the file provided with params.fasta", + "$schema": "https://json-schema.org/draft/2020-12/schema", + "$id": "https://raw.githubusercontent.com/nf-core/eager/master/assets/schema_input.json", + "title": "nf-core/eager pipeline - params.input schema", + "description": "Schema for the file provided with params.input", "type": "array", "items": { "type": "object", From a38e1d99f1fb2d2a0053597ac2e83d861418b6ac Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 29 Nov 2024 10:45:36 +0100 Subject: [PATCH 18/36] Use correct inputs to nf-validation functions --- subworkflows/local/reference_indexing_multi.nf | 2 +- subworkflows/local/utils_nfcore_eager_pipeline/main.nf | 4 ++-- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/subworkflows/local/reference_indexing_multi.nf b/subworkflows/local/reference_indexing_multi.nf index 8a5b946fd..c629c1df0 100644 --- a/subworkflows/local/reference_indexing_multi.nf +++ b/subworkflows/local/reference_indexing_multi.nf @@ -18,7 +18,7 @@ workflow REFERENCE_INDEXING_MULTI { // Import reference sheet and change empty arrays to empty strings for compatibility with single reference input ch_splitreferencesheet_for_branch = Channel - .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_fasta.json")) + .fromList(samplesheetToList(referencesheet, "${projectDir}/assets/schema_fasta.json")) .map { meta, fasta, fai, dict, mapper_index, circular_target, circularmapper_elongatedfasta, circularmapper_elongatedindex, mitochondrion, capture_bed, pileupcaller_bed, pileupcaller_snp, hapmap, pmd_masked_fasta, pmd_bed_for_masking, sexdet_bed, bedtools_feature, genotyping_gatk_dbsnp -> meta.ploidy = meta.genotyping_ploidy != null ? meta.genotyping_ploidy : params.genotyping_reference_ploidy fai = fai != [] ? fai : "" diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index 51a3dcf2f..be91c2e6b 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -69,9 +69,9 @@ workflow PIPELINE_INITIALISATION { validateInputParameters() // - // Create channel from input file provided through params.input + // Create channel from input file provided through input // - ch_samplesheet = Channel.fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) + ch_samplesheet = Channel.fromList(samplesheetToList(input, "${projectDir}/assets/schema_input.json")) .map { meta, r1, r2, bam -> meta.single_end = meta.pairment == "single" ? true : false From 53ef005f0a1387c320ce6b3cf25363794fe7dde9 Mon Sep 17 00:00:00 2001 From: Thiseas Christos Lamnidis Date: Fri, 29 Nov 2024 15:35:52 +0100 Subject: [PATCH 19/36] put fastp results in own directory --- conf/modules.config | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 09fbff1fc..aace67cf4 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -103,13 +103,13 @@ process { ext.prefix = { "${meta.sample_id}_${meta.library_id}_L${meta.lane}" } publishDir = [ [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/fastp" }, mode: params.publish_dir_mode, pattern: '*.fastq.gz', enabled: params.preprocessing_savepreprocessedreads ], [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/fastp" }, mode: params.publish_dir_mode, pattern: '*.{log,html,json}' ] @@ -133,13 +133,13 @@ process { ext.prefix = { "${meta.sample_id}_${meta.library_id}_L${meta.lane}" } publishDir = [ [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/fastp" }, mode: params.publish_dir_mode, pattern: '*.fastq.gz', enabled: params.preprocessing_savepreprocessedreads ], [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/fastp" }, mode: params.publish_dir_mode, pattern: '*.{log,html,json}' ] From d36dee2660a7c96059642e80e62232aa722ccf90 Mon Sep 17 00:00:00 2001 From: Thiseas Christos Lamnidis Date: Fri, 29 Nov 2024 15:36:45 +0100 Subject: [PATCH 20/36] Put adapter removal results in own directory --- conf/modules.config | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index aace67cf4..612e83d46 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -165,13 +165,13 @@ process { ext.prefix = { "${meta.sample_id}_${meta.library_id}_L${meta.lane}" } publishDir = [ [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/adapterremoval" }, mode: params.publish_dir_mode, pattern: '*.fastq.gz', enabled: params.preprocessing_savepreprocessedreads ], [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/adapterremoval" }, mode: params.publish_dir_mode, pattern: '*.settings' ] @@ -199,13 +199,13 @@ process { ext.prefix = { "${meta.sample_id}_${meta.library_id}_L${meta.lane}" } publishDir = [ [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/adapterremoval" }, mode: params.publish_dir_mode, pattern: '*.fastq.gz', enabled: params.preprocessing_savepreprocessedreads ], [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/adapterremoval" }, mode: params.publish_dir_mode, pattern: '*.settings' ] @@ -216,7 +216,7 @@ process { tag = { "${meta.sample_id}_${meta.library_id}_L${meta.lane}_${meta.reference}" } ext.prefix = { "${meta.sample_id}_${meta.library_id}_L${meta.lane}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/preprocessing/adapterremoval" }, mode: params.publish_dir_mode, pattern: '*.fastq.gz', enabled: params.preprocessing_savepreprocessedreads From 038ab3d3028514704fe54c391a16ac404fdaba75 Mon Sep 17 00:00:00 2001 From: Thiseas Christos Lamnidis Date: Fri, 29 Nov 2024 15:37:49 +0100 Subject: [PATCH 21/36] fix bam_filtering result directory name. Minor formatting changes --- conf/modules.config | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 612e83d46..7608564d9 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -335,7 +335,7 @@ process { tag = { "${meta.sample_id}_${meta.library_id}_${meta.reference}" } ext.prefix = { "${meta.sample_id}_${meta.library_id}_${meta.reference}" } publishDir = [ - path: { "${params.outdir}/preprocessing" }, + path: { "${params.outdir}/bam_filtering/" }, mode: params.publish_dir_mode, pattern: '*.fastq.gz', enabled: params.preprocessing_savepreprocessedreads @@ -862,7 +862,7 @@ process { path: { "${params.outdir}/damage_manipulation/" }, mode: params.publish_dir_mode, pattern: '*.{bai,csi}' - ] + ] } // @@ -1115,7 +1115,7 @@ process { ext.prefix = { "${meta2.id}_samtoolsdepth" } ext.args = '-aa -q30 -Q30 -H' publishDir = [ - enabled: false + enabled: false ] } From 9ae841589cd3d7624282495d7a25e6880dcb9313 Mon Sep 17 00:00:00 2001 From: Thiseas Christos Lamnidis Date: Fri, 29 Nov 2024 15:38:38 +0100 Subject: [PATCH 22/36] exclude versions.yml from published results. remove enabled:true statements from publishDirs. --- conf/modules.config | 51 ++++++++++++++++++++++----------------------- 1 file changed, 25 insertions(+), 26 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 7608564d9..67e030eef 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -47,6 +47,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/fastqc_raw/" }, mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -57,6 +58,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/fastqc_processed/" }, mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -76,6 +78,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/falco_raw/" }, mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -86,6 +89,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/falco_processed/" }, mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -704,7 +708,8 @@ process { ext.prefix = { "${meta.sample_id}_${meta.library_id}_${meta.reference}" } publishDir = [ path: { "${params.outdir}/mapstats/preseq" }, - mode: params.publish_dir_mode + mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -722,7 +727,8 @@ process { ext.prefix = { "${meta.sample_id}_${meta.library_id}_${meta.reference}" } publishDir = [ path: { "${params.outdir}/mapstats/preseq" }, - mode: params.publish_dir_mode + mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -742,7 +748,8 @@ process { ext.prefix = { "${meta.sample_id}_${meta.reference}_depth" } publishDir = [ path: { "${params.outdir}/mapstats/bedtools" }, - mode: params.publish_dir_mode + mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -752,7 +759,8 @@ process { ext.prefix = { "${meta.sample_id}_${meta.reference}_breadth" } publishDir = [ path: { "${params.outdir}/mapstats/bedtools" }, - mode: params.publish_dir_mode + mode: params.publish_dir_mode, + pattern: '*[!versions.yml]', ] } @@ -1066,9 +1074,9 @@ process { withName: 'QUALIMAP_BAMQC_WITHBED|QUALIMAP_BAMQC_NOBED' { tag = { "${meta.reference}|${meta.sample_id}" } publishDir = [ - path: { "${params.outdir}/mapstats/qualimap/${meta.reference}/${meta.sample_id}/}" }, + path: { "${params.outdir}/mapstats/qualimap/${meta.reference}/" }, mode: params.publish_dir_mode, - enabled: true + pattern: '*[!versions.yml]', ] } @@ -1086,7 +1094,7 @@ process { publishDir = [ path: { "${params.outdir}/damage_estimation/damageprofiler/" }, mode: params.publish_dir_mode, - enabled: true + pattern: '*[!versions.yml]' ] } @@ -1250,8 +1258,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.{geno,snp,ind}' + pattern: '*.{geno,snp,ind}', ] } @@ -1262,8 +1269,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.{tsv}' + pattern: '*.{tsv}', ] } @@ -1285,9 +1291,9 @@ process { ].join(' ').trim() ext.prefix = { "${meta.sample_id}_${meta.reference}_realigned" } publishDir = [ + enabled: params.genotyping_gatk_ug_keeprealignbam, path: { "${params.outdir}/genotyping/IndelRealigner" }, mode: params.publish_dir_mode, - enabled: params.genotyping_gatk_ug_keeprealignbam, pattern: '*.{bam,bai}' ] } @@ -1306,8 +1312,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.vcf.gz' + pattern: '*.vcf.gz', ] } @@ -1318,8 +1323,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.vcf.gz.tbi' + pattern: '*.vcf.gz.tbi', ] } @@ -1336,8 +1340,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.{vcf.gz,vcf.gz.tbi}' + pattern: '*.{vcf.gz,vcf.gz.tbi}', ] } @@ -1352,8 +1355,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.vcf.gz' + pattern: '*.vcf.gz', ] } @@ -1364,8 +1366,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.vcf.gz.tbi' + pattern: '*.vcf.gz.tbi', ] } @@ -1375,8 +1376,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.txt' + pattern: '*.txt', ] } @@ -1395,8 +1395,7 @@ process { publishDir = [ path: { "${params.outdir}/genotyping/" }, mode: params.publish_dir_mode, - enabled: true, - pattern: '*.{glf,beagle}.gz' + pattern: '*.{glf,beagle}.gz', ] } } From 5762908b3572f20f4d6c0902c54a2bf12c88d41f Mon Sep 17 00:00:00 2001 From: "Thiseas C. Lamnidis" Date: Tue, 3 Dec 2024 15:47:38 +0100 Subject: [PATCH 23/36] exclude version.yml from publishDirs --- conf/modules.config | 20 ++++++++++---------- 1 file changed, 10 insertions(+), 10 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 67e030eef..fcb14b4f1 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -47,7 +47,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/fastqc_raw/" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -58,7 +58,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/fastqc_processed/" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -78,7 +78,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/falco_raw/" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -89,7 +89,7 @@ process { publishDir = [ path: { "${params.outdir}/preprocessing/falco_processed/" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -709,7 +709,7 @@ process { publishDir = [ path: { "${params.outdir}/mapstats/preseq" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -728,7 +728,7 @@ process { publishDir = [ path: { "${params.outdir}/mapstats/preseq" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -749,7 +749,7 @@ process { publishDir = [ path: { "${params.outdir}/mapstats/bedtools" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -760,7 +760,7 @@ process { publishDir = [ path: { "${params.outdir}/mapstats/bedtools" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -1076,7 +1076,7 @@ process { publishDir = [ path: { "${params.outdir}/mapstats/qualimap/${meta.reference}/" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]', + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } @@ -1094,7 +1094,7 @@ process { publishDir = [ path: { "${params.outdir}/damage_estimation/damageprofiler/" }, mode: params.publish_dir_mode, - pattern: '*[!versions.yml]' + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } From bfb25b782462c202e35674af02f8814a64492691 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Thu, 12 Dec 2024 11:24:28 +0000 Subject: [PATCH 24/36] Template update for nf-core/tools version 3.1.0 --- .github/CONTRIBUTING.md | 12 +- .github/workflows/awsfulltest.yml | 21 +- .github/workflows/branch.yml | 18 +- .github/workflows/ci.yml | 2 +- .github/workflows/download_pipeline.yml | 8 +- .github/workflows/fix-linting.yml | 4 +- .github/workflows/linting.yml | 10 +- .github/workflows/linting_comment.yml | 2 +- .github/workflows/release-announcements.yml | 2 +- .../workflows/template_version_comment.yml | 2 +- .gitpod.yml | 11 +- .nf-core.yml | 6 +- .vscode/settings.json | 3 + conf/base.config | 2 +- conf/modules.config | 1 + docs/usage.md | 32 +- modules.json | 8 +- modules/nf-core/fastqc/main.nf | 2 +- modules/nf-core/fastqc/meta.yml | 1 + nextflow.config | 45 ++- nextflow_schema.json | 6 + ro-crate-metadata.json | 325 ++++++++++++++++++ .../local/utils_nfcore_eager_pipeline/main.nf | 7 +- .../nf-core/utils_nextflow_pipeline/main.nf | 2 + .../tests/main.workflow.nf.test | 10 +- .../nf-core/utils_nfcore_pipeline/main.nf | 89 ++--- .../tests/main.function.nf.test | 46 +-- .../tests/main.function.nf.test.snap | 30 -- .../utils_nfschema_plugin/tests/main.nf.test | 4 +- workflows/eager.nf | 2 +- 30 files changed, 495 insertions(+), 218 deletions(-) create mode 100644 .vscode/settings.json create mode 100644 ro-crate-metadata.json diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index d75c30f7a..bcd7801c8 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -1,4 +1,4 @@ -# nf-core/eager: Contributing Guidelines +# `nf-core/eager`: Contributing Guidelines Hi there! Many thanks for taking an interest in improving nf-core/eager. @@ -55,9 +55,9 @@ These tests are run both with the latest available version of `Nextflow` and als :warning: Only in the unlikely and regretful event of a release happening with a bug. -- On your own fork, make a new branch `patch` based on `upstream/master`. +- On your own fork, make a new branch `patch` based on `upstream/main` or `upstream/master`. - Fix the bug, and bump version (X.Y.Z+1). -- A PR should be made on `master` from patch to directly this particular bug. +- Open a pull-request from `patch` to `main`/`master` with the changes. ## Getting help @@ -65,13 +65,13 @@ For further information/help, please consult the [nf-core/eager documentation](h ## Pipeline contribution conventions -To make the nf-core/eager code and processing logic more understandable for new contributors and to ensure quality, we semi-standardise the way the code and other contributions are written. +To make the `nf-core/eager` code and processing logic more understandable for new contributors and to ensure quality, we semi-standardise the way the code and other contributions are written. ### Adding a new step If you wish to contribute a new step, please use the following coding standards: -1. Define the corresponding input channel into your new process from the expected previous process channel +1. Define the corresponding input channel into your new process from the expected previous process channel. 2. Write the process block (see below). 3. Define the output channel if needed (see below). 4. Add any new parameters to `nextflow.config` with a default (see below). @@ -84,7 +84,7 @@ If you wish to contribute a new step, please use the following coding standards: ### Default values -Parameters should be initialised / defined with default values in `nextflow.config` under the `params` scope. +Parameters should be initialised / defined with default values within the `params` scope in `nextflow.config`. Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index 454f353ea..2d35f6d22 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,11 +1,12 @@ name: nf-core AWS full size tests -# This workflow is triggered on PRs opened against the master branch. +# This workflow is triggered on PRs opened against the main/master branch. # It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: pull_request: branches: + - main - master workflow_dispatch: pull_request_review: @@ -18,18 +19,30 @@ jobs: if: github.repository == 'nf-core/eager' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: - - uses: octokit/request-action@v2.x + - name: Get PR reviews + uses: octokit/request-action@v2.x + if: github.event_name != 'workflow_dispatch' id: check_approvals + continue-on-error: true with: - route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews?per_page=100 env: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} - - id: test_variables + + - name: Check for approvals + if: ${{ failure() && github.event_name != 'workflow_dispatch' }} + run: | + echo "No review approvals found. At least 2 approvals are required to run this action automatically." + exit 1 + + - name: Check for enough approvals (>=2) + id: test_variables if: github.event_name != 'workflow_dispatch' run: | JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required + - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 # TODO nf-core: You can customise AWS full pipeline tests as required diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml index 3139d7519..f80367529 100644 --- a/.github/workflows/branch.yml +++ b/.github/workflows/branch.yml @@ -1,15 +1,17 @@ name: nf-core branch protection -# This workflow is triggered on PRs to master branch on the repository -# It fails when someone tries to make a PR against the nf-core `master` branch instead of `dev` +# This workflow is triggered on PRs to `main`/`master` branch on the repository +# It fails when someone tries to make a PR against the nf-core `main`/`master` branch instead of `dev` on: pull_request_target: - branches: [master] + branches: + - main + - master jobs: test: runs-on: ubuntu-latest steps: - # PRs to the nf-core repo master branch are only ok if coming from the nf-core repo `dev` or any `patch` branches + # PRs to the nf-core repo main/master branch are only ok if coming from the nf-core repo `dev` or any `patch` branches - name: Check PRs if: github.repository == 'nf-core/eager' run: | @@ -22,7 +24,7 @@ jobs: uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 with: message: | - ## This PR is against the `master` branch :x: + ## This PR is against the `${{github.event.pull_request.base.ref}}` branch :x: * Do not close this PR * Click _Edit_ and change the `base` to `dev` @@ -32,9 +34,9 @@ jobs: Hi @${{ github.event.pull_request.user.login }}, - It looks like this pull-request is has been made against the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `master` branch. - The `master` branch on nf-core repositories should always contain code from the latest release. - Because of this, PRs to `master` are only allowed if they come from the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `dev` branch. + It looks like this pull-request is has been made against the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) ${{github.event.pull_request.base.ref}} branch. + The ${{github.event.pull_request.base.ref}} branch on nf-core repositories should always contain code from the latest release. + Because of this, PRs to ${{github.event.pull_request.base.ref}} are only allowed if they come from the [${{github.event.pull_request.head.repo.full_name }}](https://github.com/${{github.event.pull_request.head.repo.full_name }}) `dev` branch. You do not need to close this PR, you can change the target branch to `dev` by clicking the _"Edit"_ button at the top of this page. Note that even after this, the test will continue to show as failing until you push a new commit. diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index fb55614ca..c32b41e2f 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -45,7 +45,7 @@ jobs: profile: "singularity" steps: - name: Check out pipeline code - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 - name: Set up Nextflow uses: nf-core/setup-nextflow@v2 diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 713dc3e73..2576cc0c7 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -2,7 +2,7 @@ name: Test successful pipeline download with 'nf-core pipelines download' # Run the workflow when: # - dispatched manually -# - when a PR is opened or reopened to master branch +# - when a PR is opened or reopened to main/master branch # - the head branch of the pull request is updated, i.e. if fixes for a release are pushed last minute to dev. on: workflow_dispatch: @@ -17,9 +17,11 @@ on: - edited - synchronize branches: + - main - master pull_request_target: branches: + - main - master env: @@ -35,7 +37,7 @@ jobs: - name: Disk space cleanup uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 with: python-version: "3.12" architecture: "x64" @@ -69,7 +71,7 @@ jobs: --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ --container-system 'singularity' \ - --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io" \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io/library/" \ --container-cache-utilisation 'amend' \ --download-configuration 'yes' diff --git a/.github/workflows/fix-linting.yml b/.github/workflows/fix-linting.yml index a2ea6d631..4f646a59f 100644 --- a/.github/workflows/fix-linting.yml +++ b/.github/workflows/fix-linting.yml @@ -13,7 +13,7 @@ jobs: runs-on: ubuntu-latest steps: # Use the @nf-core-bot token to check out so we can push later - - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 with: token: ${{ secrets.nf_core_bot_auth_token }} @@ -32,7 +32,7 @@ jobs: GITHUB_TOKEN: ${{ secrets.nf_core_bot_auth_token }} # Install and run pre-commit - - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 with: python-version: "3.12" diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index a502573c5..dbd52d5a2 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -14,10 +14,10 @@ jobs: pre-commit: runs-on: ubuntu-latest steps: - - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + - uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 - name: Set up Python 3.12 - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 with: python-version: "3.12" @@ -31,12 +31,12 @@ jobs: runs-on: ubuntu-latest steps: - name: Check out pipeline code - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 - name: Install Nextflow uses: nf-core/setup-nextflow@v2 - - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 with: python-version: "3.12" architecture: "x64" @@ -74,7 +74,7 @@ jobs: - name: Upload linting log file artifact if: ${{ always() }} - uses: actions/upload-artifact@65462800fd760344b1a7b4382951275a0abb4808 # v4 + uses: actions/upload-artifact@b4b15b8c7c6ac21ea08fcf65892d2ee8f75cf882 # v4 with: name: linting-logs path: | diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 42e519bfa..0bed96d36 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@bf251b5aa9c2f7eeb574a96ee720e24f801b7c11 # v6 + uses: dawidd6/action-download-artifact@80620a5d27ce0ae443b965134db88467fc607b43 # v7 with: workflow: linting.yml workflow_conclusion: completed diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index c6ba35df4..450b1d5e4 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -31,7 +31,7 @@ jobs: runs-on: ubuntu-latest steps: - - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + - uses: actions/setup-python@0b93645e9fea7318ecaed2b359559ac225c90a2b # v5 with: python-version: "3.10" - name: Install dependencies diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml index e8aafe44d..537529bc1 100644 --- a/.github/workflows/template_version_comment.yml +++ b/.github/workflows/template_version_comment.yml @@ -9,7 +9,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Check out pipeline code - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 with: ref: ${{ github.event.pull_request.head.sha }} diff --git a/.gitpod.yml b/.gitpod.yml index 461186376..83599f633 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -6,12 +6,5 @@ tasks: nextflow self-update vscode: - extensions: # based on nf-core.nf-core-extensionpack - #- esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - - nextflow.nextflow # Nextflow syntax highlighting - - oderwat.indent-rainbow # Highlight indentation level - - streetsidesoftware.code-spell-checker # Spelling checker for source code - - charliermarsh.ruff # Code linter Ruff + extensions: + - nf-core.nf-core-extensionpack # https://github.com/nf-core/vscode-extensionpack diff --git a/.nf-core.yml b/.nf-core.yml index 4ec9275ea..e7d509f0e 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -1,10 +1,8 @@ -bump_version: null lint: nextflow_config: - config_defaults: - params.contamination_estimation_angsd_hapmap -nf_core_version: 3.0.2 -org_path: null +nf_core_version: 3.1.0 repository_type: pipeline template: author: The nf-core/eager community @@ -14,6 +12,4 @@ template: name: eager org: nf-core outdir: . - skip_features: null version: 3.0.0dev -update: null diff --git a/.vscode/settings.json b/.vscode/settings.json new file mode 100644 index 000000000..a33b527cc --- /dev/null +++ b/.vscode/settings.json @@ -0,0 +1,3 @@ +{ + "markdown.styles": ["public/vscode_markdown.css"] +} diff --git a/conf/base.config b/conf/base.config index 870eb47ce..afb4c1add 100644 --- a/conf/base.config +++ b/conf/base.config @@ -20,7 +20,7 @@ process { maxErrors = '-1' // Process-specific resource requirements - // NOTE - Please try and re-use the labels below as much as possible. + // NOTE - Please try and reuse the labels below as much as possible. // These labels are used and recognised by default in DSL2 files hosted on nf-core/modules. // If possible, it would be nice to keep the same label naming convention when // adding in your local modules too. diff --git a/conf/modules.config b/conf/modules.config index d266a387f..d203d2b6e 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -21,6 +21,7 @@ process { withName: FASTQC { ext.args = '--quiet' } + withName: 'MULTIQC' { ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ diff --git a/docs/usage.md b/docs/usage.md index 5e5ae91b7..7e11c4391 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -75,9 +75,8 @@ If you wish to repeatedly use the same parameters for multiple runs, rather than Pipeline settings can be provided in a `yaml` or `json` file via `-params-file `. -:::warning -Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). -::: +> [!WARNING] +> Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). The above pipeline run specified with a params file in yaml format: @@ -106,23 +105,21 @@ nextflow pull nf-core/eager ### Reproducibility -It is a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you'll be running the same version of the pipeline, even if there have been changes to the code since. +It is a good idea to specify the pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you'll be running the same version of the pipeline, even if there have been changes to the code since. First, go to the [nf-core/eager releases page](https://github.com/nf-core/eager/releases) and find the latest pipeline version - numeric only (eg. `1.3.1`). Then specify this when running the pipeline with `-r` (one hyphen) - eg. `-r 1.3.1`. Of course, you can switch to another version by changing the number after the `-r` flag. This version number will be logged in reports when you run the pipeline, so that you'll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports. -To further assist in reproducbility, you can use share and re-use [parameter files](#running-the-pipeline) to repeat pipeline runs with the same settings without having to write out a command with every single parameter. +To further assist in reproducibility, you can use share and reuse [parameter files](#running-the-pipeline) to repeat pipeline runs with the same settings without having to write out a command with every single parameter. -:::tip -If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. -::: +> [!TIP] +> If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. ## Core Nextflow arguments -:::note -These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). -::: +> [!NOTE] +> These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen) ### `-profile` @@ -130,16 +127,15 @@ Use this parameter to choose a configuration profile. Profiles can give configur Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below. -:::info -We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. -::: +> [!IMPORTANT] +> We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. -The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). +The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is suported, please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). Note that multiple profiles can be loaded, for example: `-profile test,docker` - the order of arguments is important! They are loaded in sequence, so later profiles can overwrite earlier profiles. -If `-profile` is not specified, the pipeline will run locally and expect all software to be installed and available on the `PATH`. This is _not_ recommended, since it can lead to different results on different machines dependent on the computer enviroment. +If `-profile` is not specified, the pipeline will run locally and expect all software to be installed and available on the `PATH`. This is _not_ recommended, since it can lead to different results on different machines dependent on the computer environment. - `test` - A profile with a complete configuration for automated testing @@ -175,13 +171,13 @@ Specify the path to a specific config file (this is a core Nextflow command). Se ### Resource requests -Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the steps in the pipeline, if the job exits with any of the error codes specified [here](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/base.config#L18) it will automatically be resubmitted with higher requests (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped. +Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the pipeline steps, if the job exits with any of the error codes specified [here](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/base.config#L18) it will automatically be resubmitted with higher resources request (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped. To change the resource requests, please see the [max resources](https://nf-co.re/docs/usage/configuration#max-resources) and [tuning workflow resources](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources) section of the nf-core website. ### Custom Containers -In some cases you may wish to change which container or conda environment a step of the pipeline uses for a particular tool. By default nf-core pipelines use containers and software from the [biocontainers](https://biocontainers.pro/) or [bioconda](https://bioconda.github.io/) projects. However in some cases the pipeline specified version maybe out of date. +In some cases, you may wish to change the container or conda environment used by a pipeline steps for a particular tool. By default, nf-core pipelines use containers and software from the [biocontainers](https://biocontainers.pro/) or [bioconda](https://bioconda.github.io/) projects. However, in some cases the pipeline specified version maybe out of date. To use a different container from the default container or conda environment specified in a pipeline, please see the [updating tool versions](https://nf-co.re/docs/usage/configuration#updating-tool-versions) section of the nf-core website. diff --git a/modules.json b/modules.json index da2f22408..e8f72c5a9 100644 --- a/modules.json +++ b/modules.json @@ -7,7 +7,7 @@ "nf-core": { "fastqc": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "dc94b6ee04a05ddb9f7ae050712ff30a13149164", "installed_by": ["modules"] }, "multiqc": { @@ -21,17 +21,17 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", + "git_sha": "c2b22d85f30a706a3073387f30380704fcae013b", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", + "git_sha": "51ae5406a030d4da1e49e4dab49756844fdd6c7a", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { "branch": "master", - "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", + "git_sha": "2fd2cd6d0e7b273747f32e465fdc6bcc3ae0814e", "installed_by": ["subworkflows"] } } diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d8989f481..752c3a10c 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -24,7 +24,7 @@ process FASTQC { // Make list of old name and new name pairs to use for renaming in the bash while loop def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } def rename_to = old_new_pairs*.join(' ').join(' ') - def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') + def renamed_files = old_new_pairs.collect{ _old_name, new_name -> new_name }.join(' ') // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4827da7af..2b2e62b8a 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -11,6 +11,7 @@ tools: FastQC gives general quality metrics about your reads. It provides information about the quality score distribution across your reads, the per base sequence content (%A/C/G/T). + You get information about adapter contamination and other overrepresented sequences. homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ diff --git a/nextflow.config b/nextflow.config index 1257bf58d..b85f84531 100644 --- a/nextflow.config +++ b/nextflow.config @@ -38,8 +38,7 @@ params { show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' - - // Config options + trace_report_suffix = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')// Config options config_profile_name = null config_profile_description = null @@ -153,6 +152,13 @@ profiles { executor.name = 'local' executor.cpus = 4 executor.memory = 8.GB + process { + resourceLimits = [ + memory: 8.GB, + cpus : 4, + time : 1.h + ] + } } test { includeConfig 'conf/test.config' } test_full { includeConfig 'conf/test_full.config' } @@ -201,30 +207,41 @@ set -C # No clobber - prevent output redirection from overwriting files. // Disable process selector warnings by default. Use debug profile to enable warnings. nextflow.enable.configProcessNamesValidation = false -def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') timeline { enabled = true - file = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/execution_timeline_${params.trace_report_suffix}.html" } report { enabled = true - file = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/execution_report_${params.trace_report_suffix}.html" } trace { enabled = true - file = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt" + file = "${params.outdir}/pipeline_info/execution_trace_${params.trace_report_suffix}.txt" } dag { enabled = true - file = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/pipeline_dag_${params.trace_report_suffix}.html" } manifest { name = 'nf-core/eager' - author = """The nf-core/eager community""" + author = """The nf-core/eager community""" // The author field is deprecated from Nextflow version 24.10.0, use contributors instead + contributors = [ + // TODO nf-core: Update the field with the details of the contributors to your pipeline. New with Nextflow version 24.10.0 + [ + name: 'The nf-core/eager community', + affiliation: '', + email: '', + github: '', + contribution: [], // List of contribution types ('author', 'maintainer' or 'contributor') + orcid: '' + ], + ] homePage = 'https://github.com/nf-core/eager' description = """A fully reproducible and state-of-the-art ancient DNA analysis pipeline""" mainScript = 'main.nf' + defaultBranch = 'master' nextflowVersion = '!>=24.04.2' version = '3.0.0dev' doi = '' @@ -237,9 +254,10 @@ plugins { validation { defaultIgnoreParams = ["genomes"] + monochromeLogs = params.monochrome_logs help { enabled = true - command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " + command = "nextflow run nf-core/eager -profile --input samplesheet.csv --outdir " fullParameter = "help_full" showHiddenParameter = "show_hidden" beforeText = """ @@ -249,15 +267,15 @@ validation { \033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m \033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m \033[0;32m`._,._,\'\033[0m -\033[0;35m ${manifest.name} ${manifest.version}\033[0m +\033[0;35m nf-core/eager ${manifest.version}\033[0m -\033[2m----------------------------------------------------\033[0m- """ - afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} + afterText = """${manifest.doi ? "\n* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} * The nf-core framework https://doi.org/10.1038/s41587-020-0439-x * Software dependencies - https://github.com/${manifest.name}/blob/master/CITATIONS.md + https://github.com/nf-core/eager/blob/master/CITATIONS.md """ } summary { @@ -265,6 +283,3 @@ validation { afterText = validation.help.afterText } } - -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' diff --git a/nextflow_schema.json b/nextflow_schema.json index 2a53530ee..1602a3aa1 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -218,6 +218,12 @@ "description": "Base URL or local path to location of pipeline test dataset files", "default": "https://raw.githubusercontent.com/nf-core/test-datasets/", "hidden": true + }, + "trace_report_suffix": { + "type": "string", + "fa_icon": "far calendar", + "description": "Suffix to add to the trace report filename. Default is the date and time in the format yyyy-MM-dd_HH-mm-ss.", + "hidden": true } } } diff --git a/ro-crate-metadata.json b/ro-crate-metadata.json new file mode 100644 index 000000000..7e69c2996 --- /dev/null +++ b/ro-crate-metadata.json @@ -0,0 +1,325 @@ +{ + "@context": [ + "https://w3id.org/ro/crate/1.1/context", + { + "GithubService": "https://w3id.org/ro/terms/test#GithubService", + "JenkinsService": "https://w3id.org/ro/terms/test#JenkinsService", + "PlanemoEngine": "https://w3id.org/ro/terms/test#PlanemoEngine", + "TestDefinition": "https://w3id.org/ro/terms/test#TestDefinition", + "TestInstance": "https://w3id.org/ro/terms/test#TestInstance", + "TestService": "https://w3id.org/ro/terms/test#TestService", + "TestSuite": "https://w3id.org/ro/terms/test#TestSuite", + "TravisService": "https://w3id.org/ro/terms/test#TravisService", + "definition": "https://w3id.org/ro/terms/test#definition", + "engineVersion": "https://w3id.org/ro/terms/test#engineVersion", + "instance": "https://w3id.org/ro/terms/test#instance", + "resource": "https://w3id.org/ro/terms/test#resource", + "runsOn": "https://w3id.org/ro/terms/test#runsOn" + } + ], + "@graph": [ + { + "@id": "./", + "@type": "Dataset", + "creativeWorkStatus": "InProgress", + "datePublished": "2024-12-12T11:24:08+00:00", + "description": "

    \n \n \n \"nf-core/eager\"\n \n

    \n\n[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml)\n[![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)\n[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com)\n\n[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/)\n[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)\n[![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)\n[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)\n[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/eager)\n\n[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23eager-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/eager)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/eager** is a bioinformatics pipeline that ...\n\n\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))\n2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/eager \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/eager/usage) and the [parameter documentation](https://nf-co.re/eager/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/eager/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/eager/output).\n\n## Credits\n\nnf-core/eager was originally written by The nf-core/eager community.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#eager` channel](https://nfcore.slack.com/channels/eager) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n", + "hasPart": [ + { + "@id": "main.nf" + }, + { + "@id": "assets/" + }, + { + "@id": "conf/" + }, + { + "@id": "docs/" + }, + { + "@id": "docs/images/" + }, + { + "@id": "modules/" + }, + { + "@id": "modules/nf-core/" + }, + { + "@id": "workflows/" + }, + { + "@id": "subworkflows/" + }, + { + "@id": "nextflow.config" + }, + { + "@id": "README.md" + }, + { + "@id": "nextflow_schema.json" + }, + { + "@id": "CHANGELOG.md" + }, + { + "@id": "LICENSE" + }, + { + "@id": "CODE_OF_CONDUCT.md" + }, + { + "@id": "CITATIONS.md" + }, + { + "@id": "modules.json" + }, + { + "@id": "docs/usage.md" + }, + { + "@id": "docs/output.md" + }, + { + "@id": ".nf-core.yml" + }, + { + "@id": ".pre-commit-config.yaml" + }, + { + "@id": ".prettierignore" + } + ], + "isBasedOn": "https://github.com/nf-core/eager", + "license": "MIT", + "mainEntity": { + "@id": "main.nf" + }, + "mentions": [ + { + "@id": "#34ae67b2-d8db-4c6c-b44e-279523e453e7" + } + ], + "name": "nf-core/eager" + }, + { + "@id": "ro-crate-metadata.json", + "@type": "CreativeWork", + "about": { + "@id": "./" + }, + "conformsTo": [ + { + "@id": "https://w3id.org/ro/crate/1.1" + }, + { + "@id": "https://w3id.org/workflowhub/workflow-ro-crate/1.0" + } + ] + }, + { + "@id": "main.nf", + "@type": ["File", "SoftwareSourceCode", "ComputationalWorkflow"], + "creator": [ + { + "@id": "#jfy133@gmail.com" + }, + { + "@id": "https://orcid.org/0000-0002-6503-2180" + } + ], + "dateCreated": "", + "dateModified": "2024-12-12T11:24:08Z", + "dct:conformsTo": "https://bioschemas.org/profiles/ComputationalWorkflow/1.0-RELEASE/", + "keywords": [ + "nf-core", + "nextflow", + "adna", + "ancient-dna-analysis", + "ancientdna", + "genome", + "metagenomics", + "pathogen-genomics", + "population-genetics" + ], + "license": ["MIT"], + "name": ["nf-core/eager"], + "programmingLanguage": { + "@id": "https://w3id.org/workflowhub/workflow-ro-crate#nextflow" + }, + "sdPublisher": { + "@id": "https://nf-co.re/" + }, + "url": ["https://github.com/nf-core/eager", "https://nf-co.re/eager/dev/"], + "version": ["3.0.0dev"] + }, + { + "@id": "https://w3id.org/workflowhub/workflow-ro-crate#nextflow", + "@type": "ComputerLanguage", + "identifier": { + "@id": "https://www.nextflow.io/" + }, + "name": "Nextflow", + "url": { + "@id": "https://www.nextflow.io/" + }, + "version": "!>=24.04.2" + }, + { + "@id": "#34ae67b2-d8db-4c6c-b44e-279523e453e7", + "@type": "TestSuite", + "instance": [ + { + "@id": "#097abefd-a077-4f1a-875e-6b7e022e468e" + } + ], + "mainEntity": { + "@id": "main.nf" + }, + "name": "Test suite for nf-core/eager" + }, + { + "@id": "#097abefd-a077-4f1a-875e-6b7e022e468e", + "@type": "TestInstance", + "name": "GitHub Actions workflow for testing nf-core/eager", + "resource": "repos/nf-core/eager/actions/workflows/ci.yml", + "runsOn": { + "@id": "https://w3id.org/ro/terms/test#GithubService" + }, + "url": "https://api.github.com" + }, + { + "@id": "https://w3id.org/ro/terms/test#GithubService", + "@type": "TestService", + "name": "Github Actions", + "url": { + "@id": "https://github.com" + } + }, + { + "@id": "assets/", + "@type": "Dataset", + "description": "Additional files" + }, + { + "@id": "conf/", + "@type": "Dataset", + "description": "Configuration files" + }, + { + "@id": "docs/", + "@type": "Dataset", + "description": "Markdown files for documenting the pipeline" + }, + { + "@id": "docs/images/", + "@type": "Dataset", + "description": "Images for the documentation files" + }, + { + "@id": "modules/", + "@type": "Dataset", + "description": "Modules used by the pipeline" + }, + { + "@id": "modules/nf-core/", + "@type": "Dataset", + "description": "nf-core modules" + }, + { + "@id": "workflows/", + "@type": "Dataset", + "description": "Main pipeline workflows to be executed in main.nf" + }, + { + "@id": "subworkflows/", + "@type": "Dataset", + "description": "Smaller subworkflows" + }, + { + "@id": "nextflow.config", + "@type": "File", + "description": "Main Nextflow configuration file" + }, + { + "@id": "README.md", + "@type": "File", + "description": "Basic pipeline usage information" + }, + { + "@id": "nextflow_schema.json", + "@type": "File", + "description": "JSON schema for pipeline parameter specification" + }, + { + "@id": "CHANGELOG.md", + "@type": "File", + "description": "Information on changes made to the pipeline" + }, + { + "@id": "LICENSE", + "@type": "File", + "description": "The license - should be MIT" + }, + { + "@id": "CODE_OF_CONDUCT.md", + "@type": "File", + "description": "The nf-core code of conduct" + }, + { + "@id": "CITATIONS.md", + "@type": "File", + "description": "Citations needed when using the pipeline" + }, + { + "@id": "modules.json", + "@type": "File", + "description": "Version information for modules from nf-core/modules" + }, + { + "@id": "docs/usage.md", + "@type": "File", + "description": "Usage documentation" + }, + { + "@id": "docs/output.md", + "@type": "File", + "description": "Output documentation" + }, + { + "@id": ".nf-core.yml", + "@type": "File", + "description": "nf-core configuration file, configuring template features and linting rules" + }, + { + "@id": ".pre-commit-config.yaml", + "@type": "File", + "description": "Configuration file for pre-commit hooks" + }, + { + "@id": ".prettierignore", + "@type": "File", + "description": "Ignore file for prettier" + }, + { + "@id": "https://nf-co.re/", + "@type": "Organization", + "name": "nf-core", + "url": "https://nf-co.re/" + }, + { + "@id": "#jfy133@gmail.com", + "@type": "Person", + "email": "jfy133@gmail.com", + "name": "James Fellows Yates" + }, + { + "@id": "https://orcid.org/0000-0002-6503-2180", + "@type": "Person", + "email": "alexander.peltzer@uni-tuebingen.de", + "name": "Alexander Peltzer" + } + ] +} diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index 4f207d98e..e8a324add 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -116,7 +116,8 @@ workflow PIPELINE_COMPLETION { main: summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") - + def multiqc_reports = multiqc_report.toList() + // // Completion email and summary // @@ -129,7 +130,7 @@ workflow PIPELINE_COMPLETION { plaintext_email, outdir, monochrome_logs, - multiqc_report.toList() + multiqc_reports.getVal(), ) } @@ -225,7 +226,7 @@ def toolBibliographyText() { } def methodsDescriptionText(mqc_methods_yaml) { - // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file + // Convert to a named map so can be used as with familiar NXF ${workflow} variable syntax in the MultiQC YML file def meta = [:] meta.workflow = workflow.toMap() meta["manifest_map"] = workflow.manifest.toMap() diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 0fcbf7b3f..d6e593e85 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -92,10 +92,12 @@ def checkCondaChannels() { channels = config.channels } catch (NullPointerException e) { + log.debug(e) log.warn("Could not verify conda channel configuration.") return null } catch (IOException e) { + log.debug(e) log.warn("Could not verify conda channel configuration.") return null } diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test index ca964ce8e..02dbf094c 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test @@ -52,10 +52,12 @@ nextflow_workflow { } then { - assertAll( - { assert workflow.success }, - { assert workflow.stdout.contains("nextflow_workflow v9.9.9") } - ) + expect { + with(workflow) { + assert success + assert "nextflow_workflow v9.9.9" in stdout + } + } } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index 5cb7bafef..bfd258760 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -56,21 +56,6 @@ def checkProfileProvided(nextflow_cli_args) { } } -// -// Citation string for pipeline -// -def workflowCitation() { - def temp_doi_ref = "" - def manifest_doi = workflow.manifest.doi.tokenize(",") - // Handling multiple DOIs - // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers - // Removing ` ` since the manifest.doi is a string and not a proper list - manifest_doi.each { doi_ref -> - temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" - } - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + "* The nf-core framework\n" + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + "* Software dependencies\n" + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" -} - // // Generate workflow version string // @@ -150,33 +135,6 @@ def paramsSummaryMultiqc(summary_params) { return yaml_file_text } -// -// nf-core logo -// -def nfCoreLogo(monochrome_logs=true) { - def colors = logColours(monochrome_logs) as Map - String.format( - """\n - ${dashedLine(monochrome_logs)} - ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} - ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} - ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} - ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} - ${colors.green}`._,._,\'${colors.reset} - ${colors.purple} ${workflow.manifest.name} ${getWorkflowVersion()}${colors.reset} - ${dashedLine(monochrome_logs)} - """.stripIndent() - ) -} - -// -// Return dashed line -// -def dashedLine(monochrome_logs=true) { - def colors = logColours(monochrome_logs) as Map - return "-${colors.dim}----------------------------------------------------${colors.reset}-" -} - // // ANSII colours used for terminal logging // @@ -245,28 +203,24 @@ def logColours(monochrome_logs=true) { return colorcodes } -// -// Attach the multiqc report to email -// -def attachMultiqcReport(multiqc_report) { - def mqc_report = null - try { - if (workflow.success) { - mqc_report = multiqc_report.getVal() - if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { - if (mqc_report.size() > 1) { - log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") - } - mqc_report = mqc_report[0] - } +// Return a single report from an object that may be a Path or List +// +def getSingleReport(multiqc_reports) { + if (multiqc_reports instanceof Path) { + return multiqc_reports + } else if (multiqc_reports instanceof List) { + if (multiqc_reports.size() == 0) { + log.warn("[${workflow.manifest.name}] No reports found from process 'MULTIQC'") + return null + } else if (multiqc_reports.size() == 1) { + return multiqc_reports.first() + } else { + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") + return multiqc_reports.first() } + } else { + return null } - catch (Exception all) { - if (multiqc_report) { - log.warn("[${workflow.manifest.name}] Could not attach MultiQC report to summary email") - } - } - return mqc_report } // @@ -320,7 +274,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi email_fields['summary'] = summary << misc_fields // On success try attach the multiqc report - def mqc_report = attachMultiqcReport(multiqc_report) + def mqc_report = getSingleReport(multiqc_report) // Check if we are only sending emails on failure def email_address = email @@ -340,7 +294,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def email_html = html_template.toString() // Render the sendmail template - def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as MemoryUnit def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) @@ -351,14 +305,17 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi if (email_address) { try { if (plaintext_email) { -new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } + new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') + } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } ['sendmail', '-t'].execute() << sendmail_html log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") } - catch (Exception all) { + catch (Exception msg) { + log.debug(msg.toString()) + log.debug("Trying with mail instead of sendmail") // Catch failures and try with plaintext def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] mail_cmd.execute() << email_html diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test index 1dc317f8f..f117040cb 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test @@ -41,26 +41,14 @@ nextflow_function { } } - test("Test Function workflowCitation") { - - function "workflowCitation" - - then { - assertAll( - { assert function.success }, - { assert snapshot(function.result).match() } - ) - } - } - - test("Test Function nfCoreLogo") { + test("Test Function without logColours") { - function "nfCoreLogo" + function "logColours" when { function { """ - input[0] = false + input[0] = true """ } } @@ -73,9 +61,8 @@ nextflow_function { } } - test("Test Function dashedLine") { - - function "dashedLine" + test("Test Function with logColours") { + function "logColours" when { function { @@ -93,14 +80,13 @@ nextflow_function { } } - test("Test Function without logColours") { - - function "logColours" + test("Test Function getSingleReport with a single file") { + function "getSingleReport" when { function { """ - input[0] = true + input[0] = file(params.modules_testdata_base_path + '/generic/tsv/test.tsv', checkIfExists: true) """ } } @@ -108,18 +94,22 @@ nextflow_function { then { assertAll( { assert function.success }, - { assert snapshot(function.result).match() } + { assert function.result.contains("test.tsv") } ) } } - test("Test Function with logColours") { - function "logColours" + test("Test Function getSingleReport with multiple files") { + function "getSingleReport" when { function { """ - input[0] = false + input[0] = [ + file(params.modules_testdata_base_path + '/generic/tsv/test.tsv', checkIfExists: true), + file(params.modules_testdata_base_path + '/generic/tsv/network.tsv', checkIfExists: true), + file(params.modules_testdata_base_path + '/generic/tsv/expression.tsv', checkIfExists: true) + ] """ } } @@ -127,7 +117,9 @@ nextflow_function { then { assertAll( { assert function.success }, - { assert snapshot(function.result).match() } + { assert function.result.contains("test.tsv") }, + { assert !function.result.contains("network.tsv") }, + { assert !function.result.contains("expression.tsv") } ) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap index 1037232c9..02c670141 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap @@ -17,26 +17,6 @@ }, "timestamp": "2024-02-28T12:02:59.729647" }, - "Test Function nfCoreLogo": { - "content": [ - "\n\n-\u001b[2m----------------------------------------------------\u001b[0m-\n \u001b[0;32m,--.\u001b[0;30m/\u001b[0;32m,-.\u001b[0m\n\u001b[0;34m ___ __ __ __ ___ \u001b[0;32m/,-._.--~'\u001b[0m\n\u001b[0;34m |\\ | |__ __ / ` / \\ |__) |__ \u001b[0;33m} {\u001b[0m\n\u001b[0;34m | \\| | \\__, \\__/ | \\ |___ \u001b[0;32m\\`-._,-`-,\u001b[0m\n \u001b[0;32m`._,._,'\u001b[0m\n\u001b[0;35m nextflow_workflow v9.9.9\u001b[0m\n-\u001b[2m----------------------------------------------------\u001b[0m-\n" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:10.562934" - }, - "Test Function workflowCitation": { - "content": [ - "If you use nextflow_workflow for your analysis please cite:\n\n* The pipeline\n https://doi.org/10.5281/zenodo.5070524\n\n* The nf-core framework\n https://doi.org/10.1038/s41587-020-0439-x\n\n* Software dependencies\n https://github.com/nextflow_workflow/blob/master/CITATIONS.md" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:07.019761" - }, "Test Function without logColours": { "content": [ { @@ -95,16 +75,6 @@ }, "timestamp": "2024-02-28T12:03:17.969323" }, - "Test Function dashedLine": { - "content": [ - "-\u001b[2m----------------------------------------------------\u001b[0m-" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-28T12:03:14.366181" - }, "Test Function with logColours": { "content": [ { diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test index 842dc432a..8fb301648 100644 --- a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -42,7 +42,7 @@ nextflow_workflow { params { test_data = '' - outdir = 1 + outdir = null } workflow { @@ -94,7 +94,7 @@ nextflow_workflow { params { test_data = '' - outdir = 1 + outdir = null } workflow { diff --git a/workflows/eager.nf b/workflows/eager.nf index 57a93f489..8920dd09a 100644 --- a/workflows/eager.nf +++ b/workflows/eager.nf @@ -39,7 +39,7 @@ workflow EAGER { softwareVersionsToYAML(ch_versions) .collectFile( storeDir: "${params.outdir}/pipeline_info", - name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', + name: 'nf_core_' + 'eager_software_' + 'mqc_' + 'versions.yml', sort: true, newLine: true ).set { ch_collated_versions } From af80edd014cb4605d5d5045e56538da518dd73b2 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 13 Dec 2024 11:14:29 +0100 Subject: [PATCH 25/36] Ensure unique fasta per reference name --- assets/schema_fasta.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/assets/schema_fasta.json b/assets/schema_fasta.json index b921e13f3..cbdd4639f 100644 --- a/assets/schema_fasta.json +++ b/assets/schema_fasta.json @@ -142,5 +142,5 @@ "bam_reference_id": ["bam"] } }, - "allOf": [{ "uniqueEntries": "reference_name" }, { "uniqueEntries": "fasta" }] + "uniqueEntries": ["reference_name", "fasta"] } From 5ad678775c884a94a55823966f0f42c85cc38488 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 13 Dec 2024 13:47:59 +0100 Subject: [PATCH 26/36] Add contributors to manifest --- LICENSE | 2 +- nextflow.config | 341 +++++++++++++++++++++++++++++++++--------------- 2 files changed, 234 insertions(+), 109 deletions(-) diff --git a/LICENSE b/LICENSE index 364330a3c..3ea8e6f2e 100644 --- a/LICENSE +++ b/LICENSE @@ -1,6 +1,6 @@ MIT License -Copyright (c) The nf-core/eager community +Copyright (c) Alexander Peltzer, James A. Fellows Yates, Thiseas C. Lamnidis, Maxime Borry, Zandra Fagernäs, Aida Andrades Valtueña, Maxime U. Garcia, Stephen Clayton, Judith Neukamm, Selina Carlhoff, Merlin Szymanski, Ian Light-Maka, Shyamsundar Ravishankar, Judith Ballesteros Villascán, Christian Heide, & the nf-core community. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal diff --git a/nextflow.config b/nextflow.config index b85f84531..53b6121d7 100644 --- a/nextflow.config +++ b/nextflow.config @@ -11,19 +11,19 @@ params { // TODO nf-core: Specify your pipeline's command line flags // Input options - input = null + input = null // References - genome = null - igenomes_base = 's3://ngi-igenomes/igenomes/' - igenomes_ignore = false + genome = null + igenomes_base = 's3://ngi-igenomes/igenomes/' + igenomes_ignore = false // MultiQC options - multiqc_config = null - multiqc_title = null - multiqc_logo = null - max_multiqc_email_size = '25.MB' - multiqc_methods_description = null + multiqc_config = null + multiqc_title = null + multiqc_logo = null + max_multiqc_email_size = '25.MB' + multiqc_methods_description = null // Boilerplate options outdir = null @@ -38,17 +38,18 @@ params { show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' - trace_report_suffix = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')// Config options - config_profile_name = null - config_profile_description = null + trace_report_suffix = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + // Config options + config_profile_name = null + config_profile_description = null - custom_config_version = 'master' - custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" - config_profile_contact = null - config_profile_url = null + custom_config_version = 'master' + custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" + config_profile_contact = null + config_profile_url = null // Schema validation default options - validate_params = true + validate_params = true } // Load base.config by default for all pipelines @@ -56,90 +57,90 @@ includeConfig 'conf/base.config' profiles { debug { - dumpHashes = true - process.beforeScript = 'echo $HOSTNAME' - cleanup = false + dumpHashes = true + process.beforeScript = 'echo $HOSTNAME' + cleanup = false nextflow.enable.configProcessNamesValidation = true } conda { - conda.enabled = true - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - conda.channels = ['conda-forge', 'bioconda'] - apptainer.enabled = false + conda.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + conda.channels = ['conda-forge', 'bioconda'] + apptainer.enabled = false } mamba { - conda.enabled = true - conda.useMamba = true - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + conda.enabled = true + conda.useMamba = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } docker { - docker.enabled = true - conda.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false - docker.runOptions = '-u $(id -u):$(id -g)' + docker.enabled = true + conda.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + docker.runOptions = '-u $(id -u):$(id -g)' } arm { - docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' + docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' } singularity { - singularity.enabled = true - singularity.autoMounts = true - conda.enabled = false - docker.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + singularity.enabled = true + singularity.autoMounts = true + conda.enabled = false + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } podman { - podman.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + podman.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } shifter { - shifter.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - podman.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + shifter.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } charliecloud { - charliecloud.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - apptainer.enabled = false + charliecloud.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + apptainer.enabled = false } apptainer { - apptainer.enabled = true - apptainer.autoMounts = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false + apptainer.enabled = true + apptainer.autoMounts = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false } wave { apptainer.ociAutoPull = true @@ -149,19 +150,23 @@ profiles { wave.strategy = 'conda,container' } gitpod { - executor.name = 'local' - executor.cpus = 4 - executor.memory = 8.GB + executor.name = 'local' + executor.cpus = 4 + executor.memory = 8.GB process { resourceLimits = [ memory: 8.GB, - cpus : 4, - time : 1.h + cpus: 4, + time: 1.h ] } } - test { includeConfig 'conf/test.config' } - test_full { includeConfig 'conf/test_full.config' } + test { + includeConfig 'conf/test.config' + } + test_full { + includeConfig 'conf/test_full.config' + } } // Load nf-core custom profiles from different Institutions @@ -174,10 +179,10 @@ includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${pa // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled // Set to your registry if you have a mirror of containers -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' charliecloud.registry = 'quay.io' // Load igenomes.config if required @@ -226,17 +231,137 @@ dag { manifest { name = 'nf-core/eager' - author = """The nf-core/eager community""" // The author field is deprecated from Nextflow version 24.10.0, use contributors instead + author = """The nf-core/eager community""" + // The author field is deprecated from Nextflow version 24.10.0, use contributors instead contributors = [ - // TODO nf-core: Update the field with the details of the contributors to your pipeline. New with Nextflow version 24.10.0 [ - name: 'The nf-core/eager community', - affiliation: '', + name: 'Alexander Peltzer', + affiliation: 'Quantitative Biology Center, Eberhard-Karls University Tübingen, Tübingen, Germany', email: '', - github: '', - contribution: [], // List of contribution types ('author', 'maintainer' or 'contributor') - orcid: '' + github: 'apeltzer', + contribution: ['author'], + orcid: '0000-0002-6503-2180' + ], + [ + name: 'James A. Fellows Yates', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'jfy133', + contribution: ['author', 'maintainer'], + orcid: '0000-0001-5585-6277' + ], + [ + name: 'Thiseas C. Lamnidis', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'TCLamnidis', + contribution: ['author', 'maintainer'], + orcid: '0000-0003-4485-8570' + ], + [ + name: 'Maxime Borry', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'maxibor', + contribution: ['contributor'], + orcid: '0000-0001-9140-7559' + ], + [ + name: 'Zandra Fagernäs', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'ZandraFagernas', + contribution: ['contributor'], + orcid: '0000-0003-2667-3556' + ], + [ + name: 'Aida Andrades Valtueña', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'aidaanva', + contribution: ['contributor'], + orcid: '0000-0002-1737-2228' + ], + [ + name: 'Maxime U. Garcia', + affiliation: 'National Genomics Infrastructure, Science for Life Laboratory, Stockholm, Sweden', + email: '', + github: 'maxulysse', + contribution: ['contributor'], + orcid: '0000-0003-2827-9261' + ], + [ + name: 'Stephen Clayton', + affiliation: 'Max Planck Institute for the Science of Human History, Jena, Germany', + email: '', + github: 'sc13-bioinf', + contribution: ['contributor'], + orcid: '0000-0001-5223-9695' ], + [ + name: 'Judith Neukamm', + affiliation: 'Institute of Evolutionary Medicine, University of Zurich, Zurich, Switzerland', + email: '', + github: ' JudithNeukamm', + contribution: ['contributor'], + orcid: '0000-0001-8141-566X ' + ], + [ + name: 'Selina Carlhoff', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'scarlhoff', + contribution: ['contributor'], + orcid: '0000-0001-9118-2839' + ], + [ + name: 'Merlin Szymanski', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'merszym', + contribution: ['contributor'], + orcid: '0000-0001-8501-2497' + ], + [ + name: 'Ian Light-Maka', + affiliation: 'Max Planck Institute for Infection Biology, Berlin, Germany', + email: '', + github: 'ilight1542', + contribution: ['contributor'], + orcid: '0000-0001-6720-3732' + ], + [ + name: 'Shyamsundar Ravishankar', + affiliation: 'Australian Centre for Ancient DNA, University of Adelaide', + email: '', + github: 'shyama-mama', + contribution: ['contributor'], + orcid: '0000-0003-3006-6134' + ], + [ + name: 'Judith Ballesteros Villascán', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'jbv2', + contribution: ['contributor'], + orcid: '0000-0001-8501-1363' + ], + [ + name: 'J. Christian Heide', + affiliation: 'Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany', + email: '', + github: 'jch-13', + contribution: ['contributor'], + orcid: '0000-0001-8637-9039' + ], + [ + name: 'nf-core/community', + affiliation: '', + email: 'core@nf-co.re', + github: 'https://github/nf-core', + contribution: ['contributor'], + orcid: '' + ] ] homePage = 'https://github.com/nf-core/eager' description = """A fully reproducible and state-of-the-art ancient DNA analysis pipeline""" @@ -249,18 +374,18 @@ manifest { // Nextflow plugins plugins { - id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet + id 'nf-schema@2.1.1' } validation { defaultIgnoreParams = ["genomes"] - monochromeLogs = params.monochrome_logs + monochromeLogs = params.monochrome_logs help { - enabled = true - command = "nextflow run nf-core/eager -profile --input samplesheet.csv --outdir " - fullParameter = "help_full" + enabled = true + command = "nextflow run nf-core/eager -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" showHiddenParameter = "show_hidden" - beforeText = """ + beforeText = """ -\033[2m----------------------------------------------------\033[0m- \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m \033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m @@ -270,7 +395,7 @@ validation { \033[0;35m nf-core/eager ${manifest.version}\033[0m -\033[2m----------------------------------------------------\033[0m- """ - afterText = """${manifest.doi ? "\n* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} + afterText = """${manifest.doi ? "\n* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/', '')}" }.join("\n")}${manifest.doi ? "\n" : ""} * The nf-core framework https://doi.org/10.1038/s41587-020-0439-x @@ -280,6 +405,6 @@ validation { } summary { beforeText = validation.help.beforeText - afterText = validation.help.afterText + afterText = validation.help.afterText } } From 2399daa404e4069b4e748753f38139686f5478cb Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 13 Dec 2024 13:48:48 +0100 Subject: [PATCH 27/36] Fix linting --- .github/PULL_REQUEST_TEMPLATE.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 985adf2dd..e1fcb9a8a 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -8,14 +8,14 @@ These are the most common things requested on pull requests (PRs). Remember that PRs should be made against the dev branch, unless you're preparing a pipeline release. -Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/eager/tree/master/.github/CONTRIBUTING.md) +Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/eager/tree/main/.github/CONTRIBUTING.md) --> ## PR checklist - [ ] This comment contains a description of changes (with reason). - [ ] If you've fixed a bug or added code that should be tested, add tests! -- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/eager/tree/master/.github/CONTRIBUTING.md) +- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/eager/tree/main/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/eager _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. - [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). From f6d9ecaaf8fd1a27c89bf15e706d9ea4f56b5366 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 13 Dec 2024 13:57:21 +0100 Subject: [PATCH 28/36] Update subworkflows/local/utils_nfcore_eager_pipeline/main.nf --- subworkflows/local/utils_nfcore_eager_pipeline/main.nf | 1 - 1 file changed, 1 deletion(-) diff --git a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf index 3e41faab0..f68490fd1 100644 --- a/subworkflows/local/utils_nfcore_eager_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_eager_pipeline/main.nf @@ -173,7 +173,6 @@ workflow PIPELINE_COMPLETION { main: summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") def multiqc_reports = multiqc_report.toList() - // // Completion email and summary // From f7ecf25c1e28a6b8c03d41c2d5b577b9fb3446c2 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 13 Dec 2024 13:15:28 +0000 Subject: [PATCH 29/36] Try fix linting --- .github/PULL_REQUEST_TEMPLATE.md | 4 ++-- LICENSE | 2 +- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index e1fcb9a8a..985adf2dd 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -8,14 +8,14 @@ These are the most common things requested on pull requests (PRs). Remember that PRs should be made against the dev branch, unless you're preparing a pipeline release. -Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/eager/tree/main/.github/CONTRIBUTING.md) +Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/eager/tree/master/.github/CONTRIBUTING.md) --> ## PR checklist - [ ] This comment contains a description of changes (with reason). - [ ] If you've fixed a bug or added code that should be tested, add tests! -- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/eager/tree/main/.github/CONTRIBUTING.md) +- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/eager/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/eager _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. - [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). diff --git a/LICENSE b/LICENSE index 3ea8e6f2e..364330a3c 100644 --- a/LICENSE +++ b/LICENSE @@ -1,6 +1,6 @@ MIT License -Copyright (c) Alexander Peltzer, James A. Fellows Yates, Thiseas C. Lamnidis, Maxime Borry, Zandra Fagernäs, Aida Andrades Valtueña, Maxime U. Garcia, Stephen Clayton, Judith Neukamm, Selina Carlhoff, Merlin Szymanski, Ian Light-Maka, Shyamsundar Ravishankar, Judith Ballesteros Villascán, Christian Heide, & the nf-core community. +Copyright (c) The nf-core/eager community Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal From 9924bd8836146a9e4b94ae9d5b046ba3ef1bc889 Mon Sep 17 00:00:00 2001 From: "James A. Fellows Yates" Date: Fri, 13 Dec 2024 14:05:46 +0000 Subject: [PATCH 30/36] RE load modules config --- nextflow.config | 2 ++ 1 file changed, 2 insertions(+) diff --git a/nextflow.config b/nextflow.config index 1052d243f..78e1c12b3 100644 --- a/nextflow.config +++ b/nextflow.config @@ -633,3 +633,5 @@ validation { afterText = validation.help.afterText } } + +includeConfig 'conf/modules.config' From 043070c4bb10d635e893e6e9fcd5af278332f95d Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Tue, 14 Jan 2025 08:44:03 +0000 Subject: [PATCH 31/36] Template update for nf-core/tools version 3.1.2.dev0 --- .editorconfig | 4 ++ .github/ISSUE_TEMPLATE/bug_report.yml | 1 - .github/workflows/ci.yml | 2 + .github/workflows/download_pipeline.yml | 41 +++++++++++-------- .nf-core.yml | 2 +- .prettierignore | 1 + CITATIONS.md | 4 +- LICENSE | 2 +- README.md | 15 ++----- conf/test.config | 4 +- docs/output.md | 11 ++--- docs/usage.md | 2 +- nextflow.config | 3 ++ ro-crate-metadata.json | 14 +++---- .../local/utils_nfcore_eager_pipeline/main.nf | 2 +- 15 files changed, 55 insertions(+), 53 deletions(-) diff --git a/.editorconfig b/.editorconfig index 72dda289a..6d9b74cc0 100644 --- a/.editorconfig +++ b/.editorconfig @@ -31,3 +31,7 @@ indent_size = unset # ignore python and markdown [*.{py,md}] indent_style = unset + +# ignore ro-crate metadata files +[**/ro-crate-metadata.json] +insert_final_newline = unset diff --git a/.github/ISSUE_TEMPLATE/bug_report.yml b/.github/ISSUE_TEMPLATE/bug_report.yml index 46e4febcc..0765e4ff7 100644 --- a/.github/ISSUE_TEMPLATE/bug_report.yml +++ b/.github/ISSUE_TEMPLATE/bug_report.yml @@ -9,7 +9,6 @@ body: - [nf-core website: troubleshooting](https://nf-co.re/usage/troubleshooting) - [nf-core/eager pipeline documentation](https://nf-co.re/eager/usage) - - type: textarea id: description attributes: diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index c32b41e2f..56da01093 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -46,6 +46,8 @@ jobs: steps: - name: Check out pipeline code uses: actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683 # v4 + with: + fetch-depth: 0 - name: Set up Nextflow uses: nf-core/setup-nextflow@v2 diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 2576cc0c7..13b51e2c3 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -28,8 +28,12 @@ env: NXF_ANSI_LOG: false jobs: - download: + configure: runs-on: ubuntu-latest + outputs: + REPO_LOWERCASE: ${{ steps.get_repo_properties.outputs.REPO_LOWERCASE }} + REPOTITLE_LOWERCASE: ${{ steps.get_repo_properties.outputs.REPOTITLE_LOWERCASE }} + REPO_BRANCH: ${{ steps.get_repo_properties.outputs.REPO_BRANCH }} steps: - name: Install Nextflow uses: nf-core/setup-nextflow@v2 @@ -53,22 +57,27 @@ jobs: pip install git+https://github.com/nf-core/tools.git@dev - name: Get the repository name and current branch set as environment variable + id: get_repo_properties run: | - echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> ${GITHUB_ENV} - echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} - echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} + echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> "$GITHUB_OUTPUT" + echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> "$GITHUB_OUTPUT" + echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> "$GITHUB_OUTPUT" - name: Make a cache directory for the container images run: | mkdir -p ./singularity_container_images + download: + runs-on: ubuntu-latest + needs: configure + steps: - name: Download the pipeline env: NXF_SINGULARITY_CACHEDIR: ./singularity_container_images run: | - nf-core pipelines download ${{ env.REPO_LOWERCASE }} \ - --revision ${{ env.REPO_BRANCH }} \ - --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ + nf-core pipelines download ${{ needs.configure.outputs.REPO_LOWERCASE }} \ + --revision ${{ needs.configure.outputs.REPO_BRANCH }} \ + --outdir ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }} \ --compress "none" \ --container-system 'singularity' \ --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io/library/" \ @@ -76,14 +85,14 @@ jobs: --download-configuration 'yes' - name: Inspect download - run: tree ./${{ env.REPOTITLE_LOWERCASE }} + run: tree ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }} - name: Count the downloaded number of container images id: count_initial run: | image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) echo "Initial container image count: $image_count" - echo "IMAGE_COUNT_INITIAL=$image_count" >> ${GITHUB_ENV} + echo "IMAGE_COUNT_INITIAL=$image_count" >> "$GITHUB_OUTPUT" - name: Run the downloaded pipeline (stub) id: stub_run_pipeline @@ -91,27 +100,27 @@ jobs: env: NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true - run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results + run: nextflow run ./${{needs.configure.outputs.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ needs.configure.outputs.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results - name: Run the downloaded pipeline (stub run not supported) id: run_pipeline - if: ${{ job.steps.stub_run_pipeline.status == failure() }} + if: ${{ steps.stub_run_pipeline.outcome == 'failure' }} env: NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true - run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -profile test,singularity --outdir ./results + run: nextflow run ./${{ needs.configure.outputs.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ needs.configure.outputs.REPO_BRANCH }}) -profile test,singularity --outdir ./results - name: Count the downloaded number of container images id: count_afterwards run: | image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) echo "Post-pipeline run container image count: $image_count" - echo "IMAGE_COUNT_AFTER=$image_count" >> ${GITHUB_ENV} + echo "IMAGE_COUNT_AFTER=$image_count" >> "$GITHUB_OUTPUT" - name: Compare container image counts run: | - if [ "${{ env.IMAGE_COUNT_INITIAL }}" -ne "${{ env.IMAGE_COUNT_AFTER }}" ]; then - initial_count=${{ env.IMAGE_COUNT_INITIAL }} - final_count=${{ env.IMAGE_COUNT_AFTER }} + if [ "${{ steps.count_initial.outputs.IMAGE_COUNT_INITIAL }}" -ne "${{ steps.count_afterwards.outputs.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ steps.count_initial.outputs.IMAGE_COUNT_INITIAL }} + final_count=${{ steps.count_afterwards.outputs.IMAGE_COUNT_AFTER }} difference=$((final_count - initial_count)) echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" tree ./singularity_container_images diff --git a/.nf-core.yml b/.nf-core.yml index e7d509f0e..7ac5124dc 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -2,7 +2,7 @@ lint: nextflow_config: - config_defaults: - params.contamination_estimation_angsd_hapmap -nf_core_version: 3.1.0 +nf_core_version: 3.1.2.dev0 repository_type: pipeline template: author: The nf-core/eager community diff --git a/.prettierignore b/.prettierignore index 437d763d0..edd29f01e 100644 --- a/.prettierignore +++ b/.prettierignore @@ -10,3 +10,4 @@ testing/ testing* *.pyc bin/ +ro-crate-metadata.json diff --git a/CITATIONS.md b/CITATIONS.md index 503be6627..035b0d008 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,9 +12,7 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) -> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - -- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online].- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. diff --git a/LICENSE b/LICENSE index 364330a3c..9cbef6850 100644 --- a/LICENSE +++ b/LICENSE @@ -1,6 +1,6 @@ MIT License -Copyright (c) The nf-core/eager community +Copyright (c) The nf-core/eager team Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal diff --git a/README.md b/README.md index e06c6c5c7..776eeaf55 100644 --- a/README.md +++ b/README.md @@ -3,9 +3,7 @@ nf-core/eager - - -[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml) +[![GitHub Actions CI Status](https://github.com/nf-core/eager/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/ci.yml) [![GitHub Actions Linting Status](https://github.com/nf-core/eager/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/eager/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/eager/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) @@ -29,15 +27,12 @@ - - -1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)) -2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/)) +1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))2. Present QC for raw reads ([`MultiQC`](http://multiqc.info/)) ## Usage > [!NOTE] -> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. +> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow.Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. - - - + An extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file. diff --git a/conf/test.config b/conf/test.config index 8a29118ef..24c83eeac 100644 --- a/conf/test.config +++ b/conf/test.config @@ -25,8 +25,6 @@ params { // Input data // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets // TODO nf-core: Give any required params for the test so that command line flags are not needed - input = params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv' - - // Genome references + input = params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv'// Genome references genome = 'R64-1-1' } diff --git a/docs/output.md b/docs/output.md index f4a245749..fd7cea461 100644 --- a/docs/output.md +++ b/docs/output.md @@ -12,8 +12,7 @@ The directories listed below will be created in the results directory after the The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes data using the following steps: -- [FastQC](#fastqc) - Raw read QC -- [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline +- [FastQC](#fastqc) - Raw read QC- [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC @@ -27,9 +26,7 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d