Skip to content

Commit

Permalink
updated docs
Browse files Browse the repository at this point in the history
- added banner images
  • Loading branch information
sugatoray committed Jan 6, 2022
1 parent 211272f commit bc25ea2
Show file tree
Hide file tree
Showing 13 changed files with 15 additions and 3 deletions.
2 changes: 2 additions & 0 deletions README.md
Original file line number Diff line number Diff line change
@@ -1,5 +1,7 @@
# GeneSpeak

![genespeak-banner](docs/assets/images/genespeak_banner_01.png)

<!--- BADGES: START --->
[![GitHub - License](https://img.shields.io/github/license/sugatoray/genespeak?logo=github&style=flat&color=green)][#github-license]
[![PyPI - Python Version](https://img.shields.io/pypi/pyversions/genespeak?logo=pypi&style=flat&color=blue)][#pypi-package]
Expand Down
Binary file added docs/assets/images/genespeak_banner_01.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_02.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_03.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_04.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_05.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_06.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_07.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_08.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_banner_09.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Binary file added docs/assets/images/genespeak_logo.png
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
9 changes: 7 additions & 2 deletions docs/index.md
Original file line number Diff line number Diff line change
@@ -1,7 +1,12 @@
---
package_version: 0.0.5
# package:
# version: 0.0.5
# banner:
# path: assets/images/genespeak_banner_01.png
---

![genespeak-banner]({{ variables.package.banner.path }})

# **GeneSpeak**

A library to encode text as DNA and decode DNA to text.
Expand Down Expand Up @@ -71,7 +76,7 @@ print(f'Text: {text}\nEncoded DNA: {dna}\nDecoded Text: {text_from_dna}\n')
**Output**

```sh
genespeak version: {{ package_version }}
genespeak version: {{ variables.package.version }}

Text: Hello World!
Encoded DNA: TACATCTTTCGATCGATCGGACAATTTGTCGGTGACTCGATCTAACAT
Expand Down
7 changes: 6 additions & 1 deletion mkdocs.yaml
Original file line number Diff line number Diff line change
Expand Up @@ -2,7 +2,7 @@

### Project Information
site_name: genespeak
site_description: genespeak - A library to encode text as RNA and decode RNA to text
site_description: genespeak - A library to encode text as DNA and decode DNA to text
site_url: https://sugatoray.github.io/genespeak/
site_author: Sugato Ray

Expand Down Expand Up @@ -301,6 +301,11 @@ extra:
alternate:
- link: /
name: en - English
variables:
package:
version: 0.0.5
banner:
path: assets/images/genespeak_banner_01.png

extra_css:
## for: termynal (terminal animation)
Expand Down

0 comments on commit bc25ea2

Please sign in to comment.